Tagged: vasa Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 12:00 on 2012/04/29 Permalink
    Tags: , , , , , , vasa   

    Abstract submitted to EuroEvoDevo 2012 

    Germ cell development in non-spiralian lophotrochozoans: insights from a bryozoan and a brachiopod

    Bryozoa and Brachiopoda are two spiralian taxa that, unlike other spiralians, undergo non-spiral cleavage and have unique non-trochophore larvae. Previous morphological studies determined that no distinctive germline is formed during embryonic development and that germ cells first appear relatively late in larval life or after metamorphosis. These observations suggest that the specification of primordial germ cells occurs by late inductive signaling (epigenesis) rather than inheritance of maternal determinants (preformation). The molecular mechanisms involved in germ cell formation in bryozoans and brachiopods are currently unknown. We have therefore used RNASeq data to identify and then clone the conserved germline-specific genes vasa, nanos, and piwi from the bryozoan Membranipora membranacea and the brachiopod Terebratalia transversa. In situ hybridization shows that Mm-nanos transcripts are not detected in the blastomeres during early cleavage, but are localized posteriorly in the internal sac region of the late-gastrula stage and early cyphonautes larvae of M. membranacea. In addition, Mm-piwi2 mRNA is present in the cytoplasm of M. membranacea blastomeres and is broadly expressed in the larval tissues, except for the corona and apical organ. Our preliminary results suggest that the signaling related to the differentiation of bryozoan germ cells may be established earlier in ontogeny than previously thought, possibly during gastrulation. A thorough analysis of the expression patterns will provide clues for understanding the regulatory mechanisms of pluripotent and germ cell development in bryozoans and brachiopods and offer further insights about the developmental diversity of spiralians.

     
  • Bruno Vellutini 16:05 on 2012/04/23 Permalink
    Tags: , , , , , vasa   

    Colony PCR Membranipora Vasa and PiwiL1 and Terebratalia Vasa, Nanos, and Piwis 

    Colony PCR with the selected genes from the previous batch of heat shock transformations.

     
  • Bruno Vellutini 18:00 on 2012/04/18 Permalink
    Tags: , , , , , , , , vasa   

    Cloning Membranipora and Terebratalia piwi, nanos, vasa, hedgehog, smoothened, runx 

    Running a PCR overnight to clone the following genes:

    Mm: Piwi1, Vasa, Runx
    Tt: Hedgehog, Smoothened, Piwia, Piwib, Vasa, Nanos.

    First time cloning Terebratalia genes.

    19/04/12

    Membranipora bands were ok and were purified directly (and ligated), but Terebratalia were too faint:

    For this reason I ran a re-PCR for Terebratalia genes.

    20/04/12

    For the re-PCR I diluted the PCR product of the first reaction 1:20 and used as a template for a regular PCR (without changing any parameters). The bands this time were stronger, except for Piwia. Since unwanted bands appeared I had to cut the gel, extract, and purify the DNA.

    Ligation was also set for these genes.

    21/04/12

    Heat shock transformation for all genes.

     
  • Bruno Vellutini 18:23 on 2012/03/26 Permalink
    Tags: , , vasa   

    Sequencing PCR for MmVasa 

    T7 SP6
    MmVasa c6 BV65 BV70
    MmVasa c7 BV66 BV71
    MmVasa c10 BV67 BV72
    MmVasa c15 BV68 BV73
    MmVasa c17 BV69 BV74

    Sequencing PCR for colonies screened last week. Products will be dropped by the facility tomorrow.

     
  • Bruno Vellutini 18:04 on 2012/03/20 Permalink
    Tags: , , vasa   

    Colony screening for Mm DDX4 and MEX3 

    I picked 19 colonies from the previous PCRs of Mm DDX4 and Mm MEX3. Trying to find a positive colony, specially for Vasa.

    No positive colonies for MEX3. For Vasa the length was not the same as expected, but I will sequence 6, 7, 10, 15, 17 to check.

     
  • Bruno Vellutini 10:00 on 2012/03/01 Permalink
    Tags: , , , , , , , , vasa   

    PCRs for new Membranipora and Priapulus primers 

    Cloning newly collected genes of Membranipora and Priapulus. Selected genes and primers:

    Membranipora:

    Mm PIWIL1 R1 CCGTTGTTGACCTGATGCCACTTTCG
    Mm PIWIL1 R2 ACGATGTGATGCTCTCCCTGCTCCATTACC
    Mm DDX4 R1 TCTCTGTGTCTTGTCTGGCATACCCATCG
    Mm DDX4 R2 CAGTCACCTTTCTCGGGTTTGGACACTCTC
    Mm AGO2 F CTTCGCACCTCAGAGGGTAG
    Mm AGO2 R CTGGCCCTGAAAGCTACAAG
    Mm MEX3 F CCAGTGAGAGGAGCTGAACC
    Mm MEX3 R CATCACCACCACACAAGAGG
    Mm MAGOH F TCCGCCATTCTTTCTCTTTG
    Mm MAGOH R TGGTTGAATGCAAGATGGAA

    Priapulus:

    Pc PiwiA F GGGTCTTATTCTTTGTTTGC
    Pc PiwiA R TTCACGACACCATCGCAG
    Pc PiwiB R1 TGCGATACTGCCGACCATCTTCTTGTCC
    Pc PiwiB R2 ACGGGATGTGATGGGCTGTAACCTTTCG
    Pc Tudor R1 TCCACAAAATAGTAGGCAAGGCAAGGGCTC
    Pc Tudor R2 ACGCAACAGATGAACACCTCTACGGCTTGG
    Pc Mael F1 CGTGAAAGAGAGCTGGTCCAGTCAGAATGG
    Pc Mael F2 CACCGCTTCATAGCTCCAGGTGAAATCC
    Pc Mael R1 GCGGTGAAATTCCCTCATAATGCCCTTCTC
    Pc Mael R2 TGGACCAGCTCTCTTTCACGCTTATTTCG
    Pc Pum F1 ATGAACGCAGTGCCTTGGAACGACTCTCAC
    Pc Pum F2 GCAGGACGATGCTATGGTCGGCTATTTC

    01/03/2012

    Regular and first round of RACE with the above primers.

    02/03/2012

    Second round of RACE. Run a gel with only 5 µL of each to identify bands to be cut from RACE and direct purify the products of the regular PCR. Ran another gel with the remaining product to cut the bands*. Extracted promising bands and set the ligation reaction at 22:30.

    • Did not like this procedure. It is better to run the RACE PCR in 10 comb gel with whole 25 µL to get more signal and extract more.

    03/03/2012

    Heat-shock transformation and plating. Also ligation for remaining bands (Mm PIWIL1, Pc Tudor 2,3,4, Pc PUM).

    04/03/2012

    Colony PCR.

    05/03/2012

    Colony PCR for the remaining bands and repetition for some that there was no positive colonies.

    image

    06/03/2012

    Plasmid extraction using 1.5 mL of miniprep culture, sequencing reaction, and dropped at the sequencing facility.

    08/03/12

    Sequences BV25-BV64 returned.

    BV25 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV26 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV27 Membranipora membranacea Mago Nashi T7 ok T7
    BV28 Membranipora membranacea Dicer1 T7 ok + SP6
    BV29 Membranipora membranacea Dicer1 T7 ok + SP6
    BV30 Membranipora membranacea Germ Cell Less R2 T7 ok T7
    BV31 Membranipora membranacea PiwiL1 R2 b2 T7 ok T7
    BV32 Membranipora membranacea PiwiL1 R2 b2 T7 ok + SP6
    BV33 Priapulus caudatus PiwiB R2 b2 T7 ok T7
    BV34 Priapulus caudatus Tudor R2 b1 T7 ok T7
    BV35 Priapulus caudatus Maelstrom F2 T7 ok + SP6
    BV36 Priapulus caudatus Maelstrom F2 T7 ok T7
    BV37 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV38 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV39 Priapulus caudatus Tudor R2 b3 T7 ok T7
    BV40 Priapulus caudatus Tudor R2 b3 T7 ok + SP6
    BV41 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV42 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV43 Priapulus caudatus Pumilio F2 T7 ok + SP6
    BV44 Priapulus caudatus Pumilio F2 T7 ok T7
    BV45 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV46 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV47 Membranipora membranacea Mago Nashi SP6 ok + T7
    BV48 Membranipora membranacea Dicer1 SP6 ok SP6
    BV49 Membranipora membranacea Dicer1 SP6 ok SP6
    BV50 Membranipora membranacea Germ Cell Less R2 SP6 ok + T7
    BV51 Membranipora membranacea PiwiL1 R2 b2 SP6 ok + T7
    BV52 Membranipora membranacea PiwiL1 R2 b2 SP6 ok SP6
    BV53 Priapulus caudatus PiwiB R2 b2 SP6 ok + T7
    BV54 Priapulus caudatus Tudor R2 b1 SP6 ok + T7
    BV55 Priapulus caudatus Maelstrom F2 SP6 ok SP6
    BV56 Priapulus caudatus Maelstrom F2 SP6 ok + T7
    BV57 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV58 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV59 Priapulus caudatus Tudor R2 b3 SP6 ok + T7
    BV60 Priapulus caudatus Tudor R2 b3 SP6 ok SP6
    BV61 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV62 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV63 Priapulus caudatus Pumilio F2 SP6 ok SP6
    BV64 Priapulus caudatus Pumilio F2 SP6 ok + T7

     
  • Bruno Vellutini 11:37 on 2012/01/09 Permalink
    Tags: , , , , , , , , vasa   

    New ligation/transformation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1 

    08/01/12

    Set a new ligation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1; + 2 control tubes using the same amount (1.5 µl) of the control DNA insert.

    09/01/12

    Transformation using 3 µl of ligation per tube, except for Control 2 where I added 5 µl of ligation. Plated with 400 µl and waited plates to be completely dry to incubate at 37 °C at 19:00.

    NanoDrop

    Chema suggested to quantify the amount of DNA in the PCR products to be able to calculate the quantity to be used in the ligation reaction. To do this I used NanoDrop spectophotometer.

    Bn PUM1 F2 Mm MAEL F2 Mm DDX4 R2 Mm PIWIL1 R1 Mm PUM Mm TDRD1
    260/280 2.54 2.02 1.87 0.63 2.12 2.21
    260/230 0.77 1.47 0.29 -0.02 0.79 0.41
    ng/µl 56.3 207.7 24.0 -6.2 62.6 64.3

    260/280: ratio of sample absorbance at 260 and 280 nm. The ratio of absorbance at 260 and 280 nm is used to assess the purity of DNA and RNA. A ratio of ~1.8 is generally accepted as “pure” for DNA; a ratio of ~2.0 is generally accepted as “pure” for RNA. If the ratio is appreciably lower in either case, it may indicate the presence of protein, phenol or other contaminants that absorb strongly at or near 280 nm.

    260/230: ratio of sample absorbance at 260 and 230 nm. This is a secondary measure of nucleic acid purity. The 260/230 values for “pure” nucleic acid are often higher than the respective 260/280 values. They are commonly in the range of 1.8-2.2. If the ratio is appreciably lower, this may indicate the presence of co-purified contaminants.

    ng/uL: sample concentration in ng/uL based on absorbance at 260 nm and the selected analysis constant.

    From NanoDrop User Guide.

    According to Aina, the contamination at the 260/230 is from the extraction buffer and should not interfere with the ligation.

    10/01/12

    Colony growth was better this time, but I still should be getting more colonies than now for some samples. Increase in colony number might be due to the plating amount (400 µl) or even the 1 µL increase in the PCR product for the ligation.

    Gene Colonies Picked
    Bn PUM1 F2 ~10 6
    Mm MAEL F2 3 3
    Mm DDX4 R2 Many 6
    Mm Piwil1 R1 5 5
    Mm PUM ~15 6
    Mm TDRD1 ~10 6
    Control 1 7 5
    Control 2 Many 5

    Colony checking PCR started at 14:00.

    11/01/12

    No positive colonies… Repeat.

    Ms_Colony2_110112MmColony 2012-01-11 12hr 23min

     
  • Bruno Vellutini 15:02 on 2012/01/07 Permalink
    Tags: , , , , , , , vasa   

    Colony testing for Mm PIWIL2, NANOS, PUM, TDRD1, and Bn PUM1, DDX4 

    Colony picking and testing for the following genes from the RACE PCR and regular PCR with Membranipora genes. PCR started at 14:20 and samples consist of:

    Gene Colonies
    Bn PUM1 F2 1
    Mm DDX4 R2 1
    Mm PIWIL2 8
    Mm NANOS 8
    Mm PUM 5
    Mm TUDOR 3

    Mm PIWIL2 and Mm NANOS had positive colonies. Mm PUM, Mm TDRD1, and Bn PUM1 F2 were negative. Mm DDX4 R2 is probably not positive (less than 500bp).

    Colony check 2012-01-07 18hr 21min

     
  • Bruno Vellutini 13:45 on 2012/01/06 Permalink
    Tags: , , , , , vasa   

    PCR product check 

    Since no colonies grew in the first try of the RACE PCR repeating Bugula genes and new Membranipora genes, I ran a product check with 2 µl of sample + 2 µl of loading dye; also including the repetition of the regular PCR from Membranipora. Products seem to be ok although Mm DDX4 R2 and Mm PIWIL1 R1 had very faint bands. Which strongly suggests, as before, that the problem lies on the ligation/transformation steps.

    PCR check for RACE and regular PCRs

     
  • Bruno Vellutini 18:38 on 2012/01/04 Permalink
    Tags: , , , , , , vasa   

    RACE PCR for Membranipora and Bugula 

    03/01/12

    Repeating RACE PCR for Bugula genes tried previously since only Bn PUM1 F2 was amplified properly according to the PCR product check. Genes from Membranipora will also be done. Genes and primers (7 reactions):

    Bugula Membranipora
    Bn PUM1 F1 Mm PIWIL1 R1
    Bn PUM1 F2 Mm PIWIL1 R2
    Bn PUM1 R1 Mm DDX4 R1
    Bn PUM1 R2 Mm DDX4 R2
    Bn PIWIL1 R1 Mm MAEL F1
    Bn PIWIL1 R2 Mm MAEL F2
    Mm MAEL R1
    Mm MAEL R2

    1st round started at 13:00; 2nd round started at 17:40.

    04/01/12

    Agarose gel for Bugula neritina:

    Bugula RACE Pumilio and Piwi

    Only Bn PUM1 F2 had a strong band, the gel was quite similar to the previous RACE PCR run. The faint band marked with “…” Mn PUM1 R2 was cut and frozen if needed in the future.

    Gel for Membranipora membranacea:

    Membranipora RACE Maelstron, Vasa, Piwi

    Mn MAEL F2 had a strong band, as well as Mm DDX4 R2 and Mm PIWIL1 R1. I cut and frozen the short and faint bands Mm MAEL R2 and Mm PIWIL1 R2.

    Extraction and ligation done for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, and Mm PIWIL1 R1 at 17:00 and left at 4 °C overnight. Extra pipetting for mixing ligation components.

    05/01/12

    Heat shock transformation and incubated the 4 plates at 37 °C.

    06/01/12

    No colonies grew on the plates :( Actually one colony for Bn PUM1 F2. Kevin suggested to do the plating quickly and to not dry out the cells.

    I repeated the transformation using the ligation from yesterday, while transforming the regular PCR from Membranipora. Plating at 18:30.

    07/01/12

    Again the number of colonies was low, only one colony for Bn PUM1 F2 and Mm DDX4 R2. Ligation and transformation needs to be repeated. Started a colony testing for both.

    08/01/12

    Repeat the ligation for these 4 samples using the ligation control.

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel