Tagged: tudor Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 21:59 on 2012/01/11 Permalink
    Tags: , , , , , tudor   

    Debugging PCRs with Bn PUM1 F2, Mm MAEL F2, Mm PUM, Mm TDRD1 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    11/01/12

    RACE PCR: Bn PUM1 F2, Mm MAEL F2

    PCR: Mm PUM, Mm TDRD1

    BnMmPCRs 2012-01-11 19hr 04min

    I cut the bands from the RACE PCR very quickly under UV light (<10s each) and purified regular PCR directly (band was not cut from the gel). This is to be sure that exposure to UV is not damaging the samples, which could be responsible for the ligation failures.

    Standard ligation set up at 21:00 (protocol values).

    12/01/12

    Heat shock transformation and plating at 17:30, looking good.

    13/01/12

    Bn PUM1 F2 and Mm MAEL F2 did not have many colonies (6 and 3, respectively). The latter could be because of the amount of PCR product interfering in the ligation. Mm PUM and Mm TDRD1 had extra colonies and I included 6 of each in the colony check PCR, started at 10:50.

    MmColony 2012-01-13 15hr 17min

    Positive colonies! Looks like purifying PCR product directly is more worth it, if there is only one band. Apparently the UV was indeed damaging the DNA from the samples. Asterisks marks are colonies to be picked for the MiniPreps.

    Bn PUM1 F2 No positive colonies, only a 500 bp one.
    Mm MAEL F2 Positive: 1, 2, 3
    Mm PUM Positive: 3, 4, 6
    Mm TUDOR Positive: 3, 4, 5 (2 also, but bit shorter)

    15/01/12

    Add 3 mL of LB to MiniPrep tubes and leave in the shaker.

     
  • Bruno Vellutini 18:00 on 2012/01/11 Permalink
    Tags: , , , , tudor   

    Extra heat shock transformation 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    11/01/12

    I did an additional heat shock transformation using new Aina’s newest cells and the most recent ligation. Used the following samples Bn PUM1 F2, Mm MAEL F2, Mm PUM, Mm TDRD1, Control 1 (1.5 µl of ligation mix, what was left) and plated at 17:00.

    12/01/12

    Not enough colonies.

     
  • Bruno Vellutini 11:37 on 2012/01/09 Permalink
    Tags: , , , , , , , tudor,   

    New ligation/transformation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    08/01/12

    Set a new ligation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1; + 2 control tubes using the same amount (1.5 µl) of the control DNA insert.

    09/01/12

    Transformation using 3 µl of ligation per tube, except for Control 2 where I added 5 µl of ligation. Plated with 400 µl and waited plates to be completely dry to incubate at 37 °C at 19:00.

    NanoDrop

    Chema suggested to quantify the amount of DNA in the PCR products to be able to calculate the quantity to be used in the ligation reaction. To do this I used NanoDrop spectophotometer.

    Bn PUM1 F2 Mm MAEL F2 Mm DDX4 R2 Mm PIWIL1 R1 Mm PUM Mm TDRD1
    260/280 2.54 2.02 1.87 0.63 2.12 2.21
    260/230 0.77 1.47 0.29 -0.02 0.79 0.41
    ng/µl 56.3 207.7 24.0 -6.2 62.6 64.3

    260/280: ratio of sample absorbance at 260 and 280 nm. The ratio of absorbance at 260 and 280 nm is used to assess the purity of DNA and RNA. A ratio of ~1.8 is generally accepted as “pure” for DNA; a ratio of ~2.0 is generally accepted as “pure” for RNA. If the ratio is appreciably lower in either case, it may indicate the presence of protein, phenol or other contaminants that absorb strongly at or near 280 nm.

    260/230: ratio of sample absorbance at 260 and 230 nm. This is a secondary measure of nucleic acid purity. The 260/230 values for “pure” nucleic acid are often higher than the respective 260/280 values. They are commonly in the range of 1.8-2.2. If the ratio is appreciably lower, this may indicate the presence of co-purified contaminants.

    ng/uL: sample concentration in ng/uL based on absorbance at 260 nm and the selected analysis constant.

    From NanoDrop User Guide.

    According to Aina, the contamination at the 260/230 is from the extraction buffer and should not interfere with the ligation.

    10/01/12

    Colony growth was better this time, but I still should be getting more colonies than now for some samples. Increase in colony number might be due to the plating amount (400 µl) or even the 1 µL increase in the PCR product for the ligation.

    Gene Colonies Picked
    Bn PUM1 F2 ~10 6
    Mm MAEL F2 3 3
    Mm DDX4 R2 Many 6
    Mm Piwil1 R1 5 5
    Mm PUM ~15 6
    Mm TDRD1 ~10 6
    Control 1 7 5
    Control 2 Many 5

    Colony checking PCR started at 14:00.

    11/01/12

    No positive colonies… Repeat.

    Ms_Colony2_110112MmColony 2012-01-11 12hr 23min

     
  • Bruno Vellutini 15:02 on 2012/01/07 Permalink
    Tags: , , , , , , tudor,   

    Colony testing for Mm PIWIL2, NANOS, PUM, TDRD1, and Bn PUM1, DDX4 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Colony picking and testing for the following genes from the RACE PCR and regular PCR with Membranipora genes. PCR started at 14:20 and samples consist of:

    Gene Colonies
    Bn PUM1 F2 1
    Mm DDX4 R2 1
    Mm PIWIL2 8
    Mm NANOS 8
    Mm PUM 5
    Mm TUDOR 3

    Mm PIWIL2 and Mm NANOS had positive colonies. Mm PUM, Mm TDRD1, and Bn PUM1 F2 were negative. Mm DDX4 R2 is probably not positive (less than 500bp).

    Colony check 2012-01-07 18hr 21min

     
  • Bruno Vellutini 13:45 on 2012/01/06 Permalink
    Tags: , , , , tudor,   

    PCR product check 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Since no colonies grew in the first try of the RACE PCR repeating Bugula genes and new Membranipora genes, I ran a product check with 2 µl of sample + 2 µl of loading dye; also including the repetition of the regular PCR from Membranipora. Products seem to be ok although Mm DDX4 R2 and Mm PIWIL1 R1 had very faint bands. Which strongly suggests, as before, that the problem lies on the ligation/transformation steps.

    PCR check for RACE and regular PCRs

     
  • Bruno Vellutini 11:13 on 2012/01/05 Permalink
    Tags: , , , , , tudor   

    Membranipora PCR repetition 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Since the ligation was not working well I am repeating the PCR for PIWIL2, NANOS, PUM1, and TRDR1 — previously done here using the same settings. The only difference is that I set the elongation time to 2 min and not 4 min. Also, I will not add extra loading dye for running the gel, as I mistakenly did last time.

    05/01/12

    PCR started 11:00 and the bands looked ok in the gel. Mostly identical to the previous one:

    Membranipora PCR for Piwi, Nanos, Pumilio, and Tudor

    I extracted the samples and set up a ligation starting at 20:00 overnight at 4 °C.

    06/01/12

    Heat shock transformation and plating at 18:30.

    07/01/12

    All plates had colonies as shown below:

    Gene Colonies
    PIWIL2 16
    NANOS 10
    PUM 5
    TDRD1 3

    PCR for colony testing started at 14:20.

     
  • Bruno Vellutini 18:25 on 2011/12/22 Permalink
    Tags: , , , , , , tudor   

    Summary 2011 Bugula/Membranipora germline quest 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    PCR products look ok for all genes except for Bn PIWIL1 R2; there was no band.

    Bugula neritina

    • Repeat RACE PCR for Bn PIWIL1 R2 and Bn PUM1 R2.
    • Repeat ligation and transformation for Bn PUM1 F2.
    • Isolate more germline genes via BLAST.

    Membranipora membranacea

    • Repeat ligation and transformation for Mm PIWIL2, Mm PUM, and Mm TUDOR.
    • Do RACE PCR for the remaining genes (Mm PIWIL1, Mm DDX4, and Mm MAEL).
    • Prepare Mm NANOS for identity check with sequencing.
     
  • Bruno Vellutini 19:38 on 2011/12/19 Permalink
    Tags: , , , , tudor   

    Membranipora membranacea PCR for PIWIL2, NANOS, PUM1, TDRD1 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    First PCR for the bryozoan Membranipora membranacea using the primers for 4 genes related to germ/stem cell development.

    19/12/11

    Primer Tm (°C) bp
    Mm PIWIL2 F 66.3 1014
    Mm PIWIL2 R 66.7
    Mm NANOS F 66.5 868
    Mm NANOS R 66.6
    Mm PUM F 68.9 1371
    Mm PUM R 67.6
    Mm TDRD1 F 67.4 1080
    Mm TDRD1 R 66.7

    PCR temperature: 65 °C (a bit lower than what SIGMA suggests on their primers).
    PCR elongation: 4 min (giving room for long genes << 4 minutes was set before I knew the length of the genes…).
    PCR started: ~17:00.

    20/12/11

    Agarose gel electrophoresis resulted in 4 nice bands with expected length:

    Membranipora membranacea gel

    I cut the bands, extracted DNA from the gel and started the plasmid ligation at 17:00 (incubated at 4 °C).

    21/12/11

    Prepared and executed heat shock transformation for the 4 genes. Bacteria incubation started at 16:40.

    Remarks: mix of thawed bacteria with vortex ultra slow (and not flicking). Also, pipetted bacterial mix up/down once before plating them in the cultures, cells were sitting at the bottom.

    22/12/11

    Only a few colonies grew on the LB plates.

    PIWIL2 NANOS PUM TUDOR
    4 1 1 3

    Why?

    • Cell stock might old (or unfreezed/unfreezed). [but previous PCR was ok, also working for others]
    • I was not careful enough and killed cells by mechanical stress (see remarks above).
    • Transformation did not occurred properly and only a few cells incorporated the plasmids.

    I picked the colonies and set a PCR with COLONYLO program (50/72 °C annealing/elongation — 2 min) at 10:00. I sealed and put the source plates in the fridge. Incubated the new plate at 37 °C.

    Gel

    Only a single Mm NANOS colony had the gene. PIWI colony 3 had a very weak band, but possibly due to agarose contamination. The remaining colonies were negative.

    MmColony 2011-12-22 15hr 14min

     
  • Bruno Vellutini 18:10 on 2011/12/01 Permalink
    Tags: , , , , , tudor,   

    Membranipora membranacea germline BLASTing 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Candidate genes related to germline development were batch BLASTed against the transcriptome of Membranipora membranacea (unpublished) using the new BLASTer script. Six genes yield transcriptome alignments, Piwi, Pumilio, Vasa, Nanos, Maelstron, and Tudor. Here are the reverse BLAST (Membranipora sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

    Locus_4048_Transcript_4/4_Confidence_0.500_Length_3410		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		0.00e+00 <<
    	PIWIL2		55124		NP_001129193.1		0.00e+00 <<
    	PIWIL2		55124		NP_060538.2		0.00e+00
    	PIWIL1		9271		NP_001177900.1		2.06e-174
    	PIWIL4		143689		NP_689644.2		8.72e-157
    
    Locus_2928_Transcript_3/3_Confidence_0.750_Length_1492		(candidates: NANOS1, NANOS2)
    	gene		id		accession		e-value
    	NANOS1		340719		NP_955631.1		8.63e-20 <<
    	NANOS2		339345		NP_001025032.1		4.73e-18 <<
    	NANOS3		342977		NP_001092092.1		9.87e-16
    
    Locus_978_Transcript_1/1_Confidence_1.000_Length_2580		(candidates: DDX4)
    	gene		id		accession		e-value
    	DDX4		54514		NP_001160005.1		3.78e-141
    	DDX4		54514		NP_001136021.1		3.78e-141
    	DDX4		54514		NP_077726.1		3.78e-141 <<
    	DDX4		54514		NP_001160006.1		4.93e-141
    	DDX3X		1654		NP_001180346.1		7.40e-121
    	DDX3X		1654		NP_001347.3		7.40e-121
    	DDX3X		1654		NP_001180345.1		7.40e-121
    
    Locus_854_Transcript_1/2_Confidence_1.000_Length_3272		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		0.00e+00 <<
    	PIWIL1		9271		NP_001177900.1		0.00e+00
    	PIWIL4		143689		NP_689644.2		0.00e+00
    	PIWIL2		55124		NP_001129193.1		0.00e+00 <<
    	PIWIL2		55124		NP_060538.2		0.00e+00
    
    Locus_12836_Transcript_1/1_Confidence_1.000_Length_1641		(candidates: MAEL)
    	gene		id		accession		e-value
    	MAEL		84944		NP_116247.1		2.16e-27 <<
    
    Locus_1952_Transcript_9/9_Confidence_0.474_Length_5369		(candidates: PUM2, PUM1)
    	gene		id		accession		e-value
    	PUM1		9698		NP_055491.1		1.15e-166
    	PUM1		9698		NP_055491.1		2.87e-08
    	PUM1		9698		NP_001018494.1		7.47e-166 <<
    	PUM1		9698		NP_001018494.1		2.87e-08 <<
    	PUM2		23369		NP_056132.1		9.75e-166 <<
    
    Locus_3478_Transcript_2/3_Confidence_0.667_Length_6149		(candidates: TDRD1)
    	gene		id		accession		e-value
    	TDRD1		56165		NP_942090.1		9.56e-32 <<
    	TDRD1		56165		NP_942090.1		9.26e-27 <<
    	TDRD1		56165		NP_942090.1		1.93e-24 <<
    	TDRD1		56165		NP_942090.1		5.44e-19 <<
    	TDRD1		56165		NP_942090.1		2.07e-18 <<
    	TDRD1		56165		NP_942090.1		6.44e-12 <<
    	TDRD1		56165		NP_942090.1		1.10e-11 <<
    	TDRD1		56165		NP_942090.1		1.59e-10 <<
    	TDRD1		56165		NP_942090.1		6.03e-10 <<
    	TDRD1		56165		NP_942090.1		4.32e-08 <<
    	TDRD1		56165		NP_942090.1		2.80e-07 <<
    	TDRD1		56165		NP_942090.1		8.15e-07 <<
    	TDRD1		56165		NP_942090.1		4.47e-05 <<

    Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

    Primers

    PIWIL2

    Whole sequence available, regular primer pairs.

    Mm PIWIL2 F    1341-1364    5'- CCACGGTAACAGAATGGAAAGTTC -3'
                                   24 nt forward primer
                                   pct G+C:   45.8 Tm:   55.7
    
    Mm PIWIL2 R    2354-2331    5'- ACGACCACATAATGGGTAGGTGTC -3'
                                   24 nt backward primer
                                   pct G+C:   50.0 Tm:   55.7
    
                   1014 nt product for F2-B2 pair (1341-2354)
                   Optimal annealing temp:   56.8
                   pct G+C:   46.9          Tm:   78.5

    PIWIL1

    Beginning not available, need 5′ RACE primer.

    Mm PIWIL1 R1    2080-2055    5'- CCGTTGTTGACCTGATGCCACTTTCG -3'
    	                        26 nt primer on minus strand
    	                        pct G+C:   53.8 	Tm:   72.9
    Mm PIWIL1 R2     128-99      5'- ACGATGTGATGCTCTCCCTGCTCCATTACC -3'
    	                        30 nt primer on minus strand
    	                        pct G+C:   53.3 	Tm:   74.3

    DDX4

    Only 5′ RACE primer.

    Mm DDX4 R1     831-803     5'- TCTCTGTGTCTTGTCTGGCATACCCATCG -3'
    	                      29 nt primer on minus strand
    	                      pct G+C:   51.7 	Tm:   72.5
    Mm DDX4 R2      64-35      5'- CAGTCACCTTTCTCGGGTTTGGACACTCTC -3'
    	                      30 nt primer on minus strand
    	                      pct G+C:   53.3 	Tm:   72.8

    NANOS

    Primer pair.

    Mm NANOS F    111-134     5'- CTCTTGGATTTGTGCTATTGGGAC -3'
    	                     24 nt forward primer
    	                     pct G+C:   45.8 	Tm:   55.8
    
    Mm NANOS R     978-954     5'- CAGTGTGTAGGATGTGTTGACGAAG -3'
    	                      25 nt backward primer
    	                      pct G+C:   48.0 	Tm:   55.3
    
    	                 868 nt product for F1-B1 pair (111-978)
    	                 Optimal annealing temp:   56.3
    	                 pct G+C:   46.0          	Tm:   78.0

    MAEL

    Needs both RACE primers.

    Mm MAEL F1    796-824     5'- TGTATGAGTTGGAGTCGCTGTTCTGTGCC -3'
    	                     29 nt primer on plus strand
    	                     pct G+C:   51.7 	Tm:   72.5
    Mm MAEL F2    832-859     5'- ACCATAGCGGTAAAGGAATGCCCCCAAG -3'
    	                     28 nt primer on plus strand
    	                     pct G+C:   53.6 	Tm:   73.5
    
    Mm MAEL R1     537-509     5'- CGCCAGGTTTGAGGAACTGATGATAGCAC -3'
    	                      29 nt primer on minus strand
    	                      pct G+C:   51.7 	Tm:   72.5
    Mm MAEL R2     161-132     5'- ATCAGCCATACCTCCAGGGAATACACGACC -3'
    	                      30 nt primer on minus strand
    	                      pct G+C:   53.3 	Tm:   73.1

    PUM

    Whole gene.

    First option in the conserved domain and lower G+C
    Mm PUM F   3251-3275    5'- CGAAGAAGTATGCTCTGTCACCGAG -3'
    	                   25 nt forward primer
    	                   pct G+C:   52.0 	Tm:   58.2
    
    Mm PUM R    4621-4598    5'- CTCAATGCCTGAAGGGAAAGTAGG -3'
    	                    24 nt backward primer
    	                    pct G+C:   50.0 	Tm:   57.2
    
    	                 1371 nt product for F3-B6 pair (3251-4621)
    	                 Optimal annealing temp:   54.8
    	                 pct G+C:   38.2          	Tm:   75.1

    TDRD1

    5′ end not present, but conserved domains present.

    Mm TDRD1 F   1504-1527    5'- CATAGCAAAGTTCAAGGACGATGG -3'
    	                     24 nt forward primer
    	                     pct G+C:   45.8 	Tm:   56.7
    
    Mm TDRD1 R    2583-2560    5'- ACCTGGGCTGTCACACTCTCTAAC -3'
    	                      24 nt backward primer
    	                      pct G+C:   54.2 	Tm:   55.4
    
    	                 1080 nt product for F1-B1 pair (1504-2583)
    	                 Optimal annealing temp:   56.2
    	                 pct G+C:   45.3          	Tm:   77.8
     
  • Bruno Vellutini 18:00 on 2011/11/25 Permalink
    Tags: , candidate genes, , , , , , tudor,   

    Selection of germline candidate genes 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Larvae of bryozoans have blastemic cells that remain undifferentiated (or pluripotent? or else? check!) until metamorphosis when they are assigned and build the different adult tissues. Set-aside cells are quite common in organisms with biphasic life cycle and normally are reserved during larval development to differentiate into the larval body (see (10.1002/bies.950190713) for discussion).

    The question now is to check if the germ cell differentiation and stem cell maintenance in these blastemic tissues of bryozoan larvae are bound to common germ line genes and developmental context. Also, how this compare to other larvae (which ones? get some references).

    First step is to look for the presence and localization of expressed genes in bryozoans embryos. For this candidate genes related to germ line development were selected, mostly from Kerner et al. 2011 (10.1093/molbev/msr046) by searching PubMed gene database for human orthologs. Human sequences are better annotated and thus, good candidate genes (Joe S9, 2011). The selected genes are:

    It is a good idea to scan for different stem cell related genes, specially RNA-binding proteins.

    Bibliography

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel