Tagged: pumilio Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 15:02 on 2012/01/07 Permalink
    Tags: , , , , , pumilio, ,   

    Colony testing for Mm PIWIL2, NANOS, PUM, TDRD1, and Bn PUM1, DDX4 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Colony picking and testing for the following genes from the RACE PCR and regular PCR with Membranipora genes. PCR started at 14:20 and samples consist of:

    Gene Colonies
    Bn PUM1 F2 1
    Mm DDX4 R2 1
    Mm PIWIL2 8
    Mm NANOS 8
    Mm PUM 5
    Mm TUDOR 3

    Mm PIWIL2 and Mm NANOS had positive colonies. Mm PUM, Mm TDRD1, and Bn PUM1 F2 were negative. Mm DDX4 R2 is probably not positive (less than 500bp).

    Colony check 2012-01-07 18hr 21min

     
  • Bruno Vellutini 13:45 on 2012/01/06 Permalink
    Tags: , , , pumilio, ,   

    PCR product check 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Since no colonies grew in the first try of the RACE PCR repeating Bugula genes and new Membranipora genes, I ran a product check with 2 µl of sample + 2 µl of loading dye; also including the repetition of the regular PCR from Membranipora. Products seem to be ok although Mm DDX4 R2 and Mm PIWIL1 R1 had very faint bands. Which strongly suggests, as before, that the problem lies on the ligation/transformation steps.

    PCR check for RACE and regular PCRs

     
  • Bruno Vellutini 11:13 on 2012/01/05 Permalink
    Tags: , , , , pumilio,   

    Membranipora PCR repetition 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Since the ligation was not working well I am repeating the PCR for PIWIL2, NANOS, PUM1, and TRDR1 — previously done here using the same settings. The only difference is that I set the elongation time to 2 min and not 4 min. Also, I will not add extra loading dye for running the gel, as I mistakenly did last time.

    05/01/12

    PCR started 11:00 and the bands looked ok in the gel. Mostly identical to the previous one:

    Membranipora PCR for Piwi, Nanos, Pumilio, and Tudor

    I extracted the samples and set up a ligation starting at 20:00 overnight at 4 °C.

    06/01/12

    Heat shock transformation and plating at 18:30.

    07/01/12

    All plates had colonies as shown below:

    Gene Colonies
    PIWIL2 16
    NANOS 10
    PUM 5
    TDRD1 3

    PCR for colony testing started at 14:20.

     
  • Bruno Vellutini 18:38 on 2012/01/04 Permalink
    Tags: , , , , , pumilio,   

    RACE PCR for Membranipora and Bugula 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    03/01/12

    Repeating RACE PCR for Bugula genes tried previously since only Bn PUM1 F2 was amplified properly according to the PCR product check. Genes from Membranipora will also be done. Genes and primers (7 reactions):

    Bugula Membranipora
    Bn PUM1 F1 Mm PIWIL1 R1
    Bn PUM1 F2 Mm PIWIL1 R2
    Bn PUM1 R1 Mm DDX4 R1
    Bn PUM1 R2 Mm DDX4 R2
    Bn PIWIL1 R1 Mm MAEL F1
    Bn PIWIL1 R2 Mm MAEL F2
    Mm MAEL R1
    Mm MAEL R2

    1st round started at 13:00; 2nd round started at 17:40.

    04/01/12

    Agarose gel for Bugula neritina:

    Bugula RACE Pumilio and Piwi

    Only Bn PUM1 F2 had a strong band, the gel was quite similar to the previous RACE PCR run. The faint band marked with “…” Mn PUM1 R2 was cut and frozen if needed in the future.

    Gel for Membranipora membranacea:

    Membranipora RACE Maelstron, Vasa, Piwi

    Mn MAEL F2 had a strong band, as well as Mm DDX4 R2 and Mm PIWIL1 R1. I cut and frozen the short and faint bands Mm MAEL R2 and Mm PIWIL1 R2.

    Extraction and ligation done for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, and Mm PIWIL1 R1 at 17:00 and left at 4 °C overnight. Extra pipetting for mixing ligation components.

    05/01/12

    Heat shock transformation and incubated the 4 plates at 37 °C.

    06/01/12

    No colonies grew on the plates :( Actually one colony for Bn PUM1 F2. Kevin suggested to do the plating quickly and to not dry out the cells.

    I repeated the transformation using the ligation from yesterday, while transforming the regular PCR from Membranipora. Plating at 18:30.

    07/01/12

    Again the number of colonies was low, only one colony for Bn PUM1 F2 and Mm DDX4 R2. Ligation and transformation needs to be repeated. Started a colony testing for both.

    08/01/12

    Repeat the ligation for these 4 samples using the ligation control.

     
  • Bruno Vellutini 17:59 on 2012/01/04 Permalink
    Tags: , , , pumilio   

    Colony testing for PUM and PIWI 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Aina repeated the ligation for Nanos, Pumilio, and Piwi from the regular PCR of Membranipora. No colonies grew for Nanos. From the few colonies in the other two plates only one colony had the plasmid with the gene: Piwi 7.

    Membranipora colony testing

     
  • Bruno Vellutini 18:25 on 2011/12/22 Permalink
    Tags: , , , , , pumilio,   

    Summary 2011 Bugula/Membranipora germline quest 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    PCR products look ok for all genes except for Bn PIWIL1 R2; there was no band.

    Bugula neritina

    • Repeat RACE PCR for Bn PIWIL1 R2 and Bn PUM1 R2.
    • Repeat ligation and transformation for Bn PUM1 F2.
    • Isolate more germline genes via BLAST.

    Membranipora membranacea

    • Repeat ligation and transformation for Mm PIWIL2, Mm PUM, and Mm TUDOR.
    • Do RACE PCR for the remaining genes (Mm PIWIL1, Mm DDX4, and Mm MAEL).
    • Prepare Mm NANOS for identity check with sequencing.
     
  • Bruno Vellutini 19:38 on 2011/12/19 Permalink
    Tags: , , , pumilio,   

    Membranipora membranacea PCR for PIWIL2, NANOS, PUM1, TDRD1 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    First PCR for the bryozoan Membranipora membranacea using the primers for 4 genes related to germ/stem cell development.

    19/12/11

    Primer Tm (°C) bp
    Mm PIWIL2 F 66.3 1014
    Mm PIWIL2 R 66.7
    Mm NANOS F 66.5 868
    Mm NANOS R 66.6
    Mm PUM F 68.9 1371
    Mm PUM R 67.6
    Mm TDRD1 F 67.4 1080
    Mm TDRD1 R 66.7

    PCR temperature: 65 °C (a bit lower than what SIGMA suggests on their primers).
    PCR elongation: 4 min (giving room for long genes << 4 minutes was set before I knew the length of the genes…).
    PCR started: ~17:00.

    20/12/11

    Agarose gel electrophoresis resulted in 4 nice bands with expected length:

    Membranipora membranacea gel

    I cut the bands, extracted DNA from the gel and started the plasmid ligation at 17:00 (incubated at 4 °C).

    21/12/11

    Prepared and executed heat shock transformation for the 4 genes. Bacteria incubation started at 16:40.

    Remarks: mix of thawed bacteria with vortex ultra slow (and not flicking). Also, pipetted bacterial mix up/down once before plating them in the cultures, cells were sitting at the bottom.

    22/12/11

    Only a few colonies grew on the LB plates.

    PIWIL2 NANOS PUM TUDOR
    4 1 1 3

    Why?

    • Cell stock might old (or unfreezed/unfreezed). [but previous PCR was ok, also working for others]
    • I was not careful enough and killed cells by mechanical stress (see remarks above).
    • Transformation did not occurred properly and only a few cells incorporated the plasmids.

    I picked the colonies and set a PCR with COLONYLO program (50/72 °C annealing/elongation — 2 min) at 10:00. I sealed and put the source plates in the fridge. Incubated the new plate at 37 °C.

    Gel

    Only a single Mm NANOS colony had the gene. PIWI colony 3 had a very weak band, but possibly due to agarose contamination. The remaining colonies were negative.

    MmColony 2011-12-22 15hr 14min

     
  • Bruno Vellutini 19:35 on 2011/12/12 Permalink
    Tags: , , , pumilio   

    Bugula neritina RACE PCR for Pumilio and Piwi 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    12/12/11

    Setting up the first round for RACE PCR of 2 Bugula neritina genes, PUM1 (pumilio) and PIWIL1 (piwi), identified before. Using existing 5′ and 3′ cDNA templates from the lab from the Bn gene expression paper (10.1186/2041-9139-2-13).

    PUM1 — incomplete, needs both 5′ and 3′ ends.

    PIWIL1 — only needs 5′ end.

    PRIMERS — Bn PUM1 F1, Bn PUM1 R1, Bn PIWIL1 R1

    Started 3 reactions at 17:00 using BDRACE program and samples will be left overnight in the cycler.

    13/12/11

    Started second round for 3 reactions (+2 controls each) using the first round as templates at 17:00 using BDRACE program and samples will be left overnight in the cycler.

    PRIMERS — Bn PUM1 F2, Bn PUM1 R2, Bn PIWIL1 R2 (+ GS and NUP controls).

    14/12/11

    Running the gel with the amplified products. Two bands were present (a 5′ RACE and a 3′ RACE).

    PUM1 F2: strong band around 1500 bp
    PUM1 R2: no band
    PIWIL1 R2: faint band around 1500 bp

    Cut bands and started a ligation reaction at 17:00 and incubated at 4 °C.

    Bn_RACE_141211

    15/12/11

    Executed heat shock transformation for bacteria to incorporate plasmids and setup cultures. Incubated the plates at 37 °C overnight.

    16/12/11

    Both plates (Pumilio F2 and Piwi R2) had cultures. Plates were transferred to the fridge until Monday.

    19/12/11

    PCR colony testing

    • Chose 8 colonies from each plate and circled them.
    • Set up 16 eppendorfs (2mL) with quantities as in the protocol.
    • Picked each colony with a stick (inside tip) and put them inside each tube.
    • Draw grid and identifications on a new plate taken from the cold room and pass the point of the toothpick in each field.
    • Sealed 2 source plates with parafilm and incubated new plate at 37 °C.
    • PCR ~16:00 (35 cycles, temp?) and kept at 4 °C in the cycler.

    20/12/11

    Ran the gel with 8 Piwi colonies and 8 Pumilio colonies at 11:00 (100V, 45min). No colony product showed the expected length of ~1500bp.

    Bugula neritina colony testing gel

    NEEDS TO BE REPEATED

    Bibliography

     
  • Bruno Vellutini 18:10 on 2011/12/01 Permalink
    Tags: , , , , pumilio, ,   

    Membranipora membranacea germline BLASTing 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Candidate genes related to germline development were batch BLASTed against the transcriptome of Membranipora membranacea (unpublished) using the new BLASTer script. Six genes yield transcriptome alignments, Piwi, Pumilio, Vasa, Nanos, Maelstron, and Tudor. Here are the reverse BLAST (Membranipora sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

    Locus_4048_Transcript_4/4_Confidence_0.500_Length_3410		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		0.00e+00 <<
    	PIWIL2		55124		NP_001129193.1		0.00e+00 <<
    	PIWIL2		55124		NP_060538.2		0.00e+00
    	PIWIL1		9271		NP_001177900.1		2.06e-174
    	PIWIL4		143689		NP_689644.2		8.72e-157
    
    Locus_2928_Transcript_3/3_Confidence_0.750_Length_1492		(candidates: NANOS1, NANOS2)
    	gene		id		accession		e-value
    	NANOS1		340719		NP_955631.1		8.63e-20 <<
    	NANOS2		339345		NP_001025032.1		4.73e-18 <<
    	NANOS3		342977		NP_001092092.1		9.87e-16
    
    Locus_978_Transcript_1/1_Confidence_1.000_Length_2580		(candidates: DDX4)
    	gene		id		accession		e-value
    	DDX4		54514		NP_001160005.1		3.78e-141
    	DDX4		54514		NP_001136021.1		3.78e-141
    	DDX4		54514		NP_077726.1		3.78e-141 <<
    	DDX4		54514		NP_001160006.1		4.93e-141
    	DDX3X		1654		NP_001180346.1		7.40e-121
    	DDX3X		1654		NP_001347.3		7.40e-121
    	DDX3X		1654		NP_001180345.1		7.40e-121
    
    Locus_854_Transcript_1/2_Confidence_1.000_Length_3272		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		0.00e+00 <<
    	PIWIL1		9271		NP_001177900.1		0.00e+00
    	PIWIL4		143689		NP_689644.2		0.00e+00
    	PIWIL2		55124		NP_001129193.1		0.00e+00 <<
    	PIWIL2		55124		NP_060538.2		0.00e+00
    
    Locus_12836_Transcript_1/1_Confidence_1.000_Length_1641		(candidates: MAEL)
    	gene		id		accession		e-value
    	MAEL		84944		NP_116247.1		2.16e-27 <<
    
    Locus_1952_Transcript_9/9_Confidence_0.474_Length_5369		(candidates: PUM2, PUM1)
    	gene		id		accession		e-value
    	PUM1		9698		NP_055491.1		1.15e-166
    	PUM1		9698		NP_055491.1		2.87e-08
    	PUM1		9698		NP_001018494.1		7.47e-166 <<
    	PUM1		9698		NP_001018494.1		2.87e-08 <<
    	PUM2		23369		NP_056132.1		9.75e-166 <<
    
    Locus_3478_Transcript_2/3_Confidence_0.667_Length_6149		(candidates: TDRD1)
    	gene		id		accession		e-value
    	TDRD1		56165		NP_942090.1		9.56e-32 <<
    	TDRD1		56165		NP_942090.1		9.26e-27 <<
    	TDRD1		56165		NP_942090.1		1.93e-24 <<
    	TDRD1		56165		NP_942090.1		5.44e-19 <<
    	TDRD1		56165		NP_942090.1		2.07e-18 <<
    	TDRD1		56165		NP_942090.1		6.44e-12 <<
    	TDRD1		56165		NP_942090.1		1.10e-11 <<
    	TDRD1		56165		NP_942090.1		1.59e-10 <<
    	TDRD1		56165		NP_942090.1		6.03e-10 <<
    	TDRD1		56165		NP_942090.1		4.32e-08 <<
    	TDRD1		56165		NP_942090.1		2.80e-07 <<
    	TDRD1		56165		NP_942090.1		8.15e-07 <<
    	TDRD1		56165		NP_942090.1		4.47e-05 <<

    Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

    Primers

    PIWIL2

    Whole sequence available, regular primer pairs.

    Mm PIWIL2 F    1341-1364    5'- CCACGGTAACAGAATGGAAAGTTC -3'
                                   24 nt forward primer
                                   pct G+C:   45.8 Tm:   55.7
    
    Mm PIWIL2 R    2354-2331    5'- ACGACCACATAATGGGTAGGTGTC -3'
                                   24 nt backward primer
                                   pct G+C:   50.0 Tm:   55.7
    
                   1014 nt product for F2-B2 pair (1341-2354)
                   Optimal annealing temp:   56.8
                   pct G+C:   46.9          Tm:   78.5

    PIWIL1

    Beginning not available, need 5′ RACE primer.

    Mm PIWIL1 R1    2080-2055    5'- CCGTTGTTGACCTGATGCCACTTTCG -3'
    	                        26 nt primer on minus strand
    	                        pct G+C:   53.8 	Tm:   72.9
    Mm PIWIL1 R2     128-99      5'- ACGATGTGATGCTCTCCCTGCTCCATTACC -3'
    	                        30 nt primer on minus strand
    	                        pct G+C:   53.3 	Tm:   74.3

    DDX4

    Only 5′ RACE primer.

    Mm DDX4 R1     831-803     5'- TCTCTGTGTCTTGTCTGGCATACCCATCG -3'
    	                      29 nt primer on minus strand
    	                      pct G+C:   51.7 	Tm:   72.5
    Mm DDX4 R2      64-35      5'- CAGTCACCTTTCTCGGGTTTGGACACTCTC -3'
    	                      30 nt primer on minus strand
    	                      pct G+C:   53.3 	Tm:   72.8

    NANOS

    Primer pair.

    Mm NANOS F    111-134     5'- CTCTTGGATTTGTGCTATTGGGAC -3'
    	                     24 nt forward primer
    	                     pct G+C:   45.8 	Tm:   55.8
    
    Mm NANOS R     978-954     5'- CAGTGTGTAGGATGTGTTGACGAAG -3'
    	                      25 nt backward primer
    	                      pct G+C:   48.0 	Tm:   55.3
    
    	                 868 nt product for F1-B1 pair (111-978)
    	                 Optimal annealing temp:   56.3
    	                 pct G+C:   46.0          	Tm:   78.0

    MAEL

    Needs both RACE primers.

    Mm MAEL F1    796-824     5'- TGTATGAGTTGGAGTCGCTGTTCTGTGCC -3'
    	                     29 nt primer on plus strand
    	                     pct G+C:   51.7 	Tm:   72.5
    Mm MAEL F2    832-859     5'- ACCATAGCGGTAAAGGAATGCCCCCAAG -3'
    	                     28 nt primer on plus strand
    	                     pct G+C:   53.6 	Tm:   73.5
    
    Mm MAEL R1     537-509     5'- CGCCAGGTTTGAGGAACTGATGATAGCAC -3'
    	                      29 nt primer on minus strand
    	                      pct G+C:   51.7 	Tm:   72.5
    Mm MAEL R2     161-132     5'- ATCAGCCATACCTCCAGGGAATACACGACC -3'
    	                      30 nt primer on minus strand
    	                      pct G+C:   53.3 	Tm:   73.1

    PUM

    Whole gene.

    First option in the conserved domain and lower G+C
    Mm PUM F   3251-3275    5'- CGAAGAAGTATGCTCTGTCACCGAG -3'
    	                   25 nt forward primer
    	                   pct G+C:   52.0 	Tm:   58.2
    
    Mm PUM R    4621-4598    5'- CTCAATGCCTGAAGGGAAAGTAGG -3'
    	                    24 nt backward primer
    	                    pct G+C:   50.0 	Tm:   57.2
    
    	                 1371 nt product for F3-B6 pair (3251-4621)
    	                 Optimal annealing temp:   54.8
    	                 pct G+C:   38.2          	Tm:   75.1

    TDRD1

    5′ end not present, but conserved domains present.

    Mm TDRD1 F   1504-1527    5'- CATAGCAAAGTTCAAGGACGATGG -3'
    	                     24 nt forward primer
    	                     pct G+C:   45.8 	Tm:   56.7
    
    Mm TDRD1 R    2583-2560    5'- ACCTGGGCTGTCACACTCTCTAAC -3'
    	                      24 nt backward primer
    	                      pct G+C:   54.2 	Tm:   55.4
    
    	                 1080 nt product for F1-B1 pair (1504-2583)
    	                 Optimal annealing temp:   56.2
    	                 pct G+C:   45.3          	Tm:   77.8
     
  • Bruno Vellutini 18:00 on 2011/12/01 Permalink
    Tags: , , , , , pumilio   

    Bugula neritina germline BLASTing 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Candidate genes related to germline development were batch BLASTed against the transcriptome of Bugula neritina using the new BLASTer script. Only 2 genes yield transcriptome alignments, Piwi and Pumilio. Here are the reverse BLAST (Bugula sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

    gnl|SRA|SRR034781.65778.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_060538.2		2.45e-29
    	PIWIL2		55124		NP_060538.2		2.45e-29
    
    gnl|SRA|SRR034781.74499.2		(candidates: PIWIL2)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.21e-33
    	PIWIL3		440822		NP_001008496.2		8.22e-29
    	PIWIL4		143689		NP_689644.2		2.39e-28
    	PIWIL2		55124		NP_001129193.1		1.31e-26 <<
    	PIWIL2		55124		NP_060538.2		1.31e-26
    
    gnl|SRA|SRR034781.49286.2		(candidates: PUM2, PUM1)
    	gene		id		accession		e-value
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		3.43e-11 <<
    	PUM1		9698		NP_001018494.1		1.22e-08 <<
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		2.62e-11
    	PUM1		9698		NP_055491.1		1.10e-09
    
    gnl|SRA|SRR034781.80037.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.61e-32 <<
    	PIWIL3		440822		NP_001008496.2		5.27e-28
    	PIWIL4		143689		NP_689644.2		2.00e-27
    	PIWIL2		55124		NP_001129193.1		8.42e-26 <<
    	PIWIL2		55124		NP_060538.2		8.42e-26

    Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

    Obs: low number of hits may be due to the quality of the transcriptome assembly, sequences seem to be short.

    Primers

    PUM1

    5′ and 3′ RACE primers needed

    Bn PUM1 F1    48-77      5'- CCAGACCAGACGGATGTGATTCTCTCAGAG -3'
    	                    30 nt primer on plus strand
    	                    pct G+C:   53.3 	Tm:   72.4
    Bn PUM1 F2    136-164    5'- ACGTGCTGGAACACGGTAGACTGGAGGAG -3'
    	                    29 nt primer on plus strand
    	                    pct G+C:   58.6 	Tm:   74.1
    
    Bn PUM1 R1    456-429    5'- ACTTCCTCAGTGTAGAAACATGGGGGCG -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   72.1
    Bn PUM1 R2    120-93     5'- TGCCATACTGATCCATCACCAGTCGGTC -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   73.3

    PIWIL1

    Only 5′ RACE primers needed.

    Bn PIWIL1 R1             5'- AACTGCCCATCTCCAACTCCATCACGGTAG -3'
    Bn PIWIL1 R2             5'- TTAGGGAAGCCACAAAACCACCGACAG -3'
     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel