Tagged: pumilio Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 12:29 on 2012/07/23 Permalink
    Tags: , , , , , , , pumilio, , , ,   

    PCR mostly stem/germ cell genes of Terebratalia 

    Setting up a pcr with gradient (63 +- 3 °C) at 12h:

    Gene Primers Tm mean
    Mm Six3/6 64.10
    Tt Dicer1b 61.60
    Tt Runx 63.15
    Tt Mael 65.15
    Tt Piwia 65.55
    Tt Tudor1 61.95
    Tt Ago 62.95
    Tt PL10 63.10
    Tt Pum 65.35

    Extraction and ligation overnight at 4°C, except for MAEL.

    24/07/12

    Transformation and plating of colonies.

    25/07/12

    PL10 and Pumilio had very few colonies on the plate (insert numbers) and together with Piwia they did not produce any positive colony.

    27/07/12

    Put positive colonies to grow for minipreps.

    BV162 Terebratalia transversa Dicer1b
    BV163 Terebratalia transversa Dicer1b
    BV164 Terebratalia transversa Runx2
    BV165 Terebratalia transversa Runx2
    BV166 Terebratalia transversa Runx2
    BV167 Terebratalia transversa Tudor1
    BV168 Terebratalia transversa Argonaute
    BV169 Terebratalia transversa Argonaute
    BV170 Terebratalia transversa Argonaute
    BV171 Terebratalia transversa NK6
    BV172 Terebratalia transversa NK6
    BV173 Terebratalia transversa NK6
    BV174 Terebratalia transversa Wnt7
    BV175 Terebratalia transversa Wnt7
    BV176 Terebratalia transversa Wnt7

     
  • Bruno Vellutini 15:19 on 2012/05/24 Permalink
    Tags: , , , , , pumilio, , ,   

    Primers for more Terebratalia germline genes have arrived.

    • Tt dicer1b
    • Tt runx2
    • Tt maelstrom
    • Tt tudor1
    • Tt pl10
    • Tt ago
    • Tt pum
     
  • Bruno Vellutini 18:00 on 2012/03/23 Permalink
    Tags: , , , , , pumilio,   

    In situ Membranipora nanos, piwi2, maelstrom, pumilio, tudor 

    Treated the samples for 1 min in proteinase-k, and then 2 washes in glycine. Put in prehybe at 20:00.

    25/03/12

    Started hybridization at 14:00.

    27/03/12

    Regular washes.

    29/03/12

    Developing from 11:30.

    Summary

    In the last days there were no embryos left (only some cyphonautes shells). The 1 min prot-k treatment with regular 5 min washes in glycine seems to be too much for them. Also, the longer period in prehybe possibly was not nice either.

     
  • Bruno Vellutini 10:00 on 2012/03/01 Permalink
    Tags: , , , , , , pumilio, ,   

    PCRs for new Membranipora and Priapulus primers 

    Cloning newly collected genes of Membranipora and Priapulus. Selected genes and primers:

    Membranipora:

    Mm PIWIL1 R1 CCGTTGTTGACCTGATGCCACTTTCG
    Mm PIWIL1 R2 ACGATGTGATGCTCTCCCTGCTCCATTACC
    Mm DDX4 R1 TCTCTGTGTCTTGTCTGGCATACCCATCG
    Mm DDX4 R2 CAGTCACCTTTCTCGGGTTTGGACACTCTC
    Mm AGO2 F CTTCGCACCTCAGAGGGTAG
    Mm AGO2 R CTGGCCCTGAAAGCTACAAG
    Mm MEX3 F CCAGTGAGAGGAGCTGAACC
    Mm MEX3 R CATCACCACCACACAAGAGG
    Mm MAGOH F TCCGCCATTCTTTCTCTTTG
    Mm MAGOH R TGGTTGAATGCAAGATGGAA

    Priapulus:

    Pc PiwiA F GGGTCTTATTCTTTGTTTGC
    Pc PiwiA R TTCACGACACCATCGCAG
    Pc PiwiB R1 TGCGATACTGCCGACCATCTTCTTGTCC
    Pc PiwiB R2 ACGGGATGTGATGGGCTGTAACCTTTCG
    Pc Tudor R1 TCCACAAAATAGTAGGCAAGGCAAGGGCTC
    Pc Tudor R2 ACGCAACAGATGAACACCTCTACGGCTTGG
    Pc Mael F1 CGTGAAAGAGAGCTGGTCCAGTCAGAATGG
    Pc Mael F2 CACCGCTTCATAGCTCCAGGTGAAATCC
    Pc Mael R1 GCGGTGAAATTCCCTCATAATGCCCTTCTC
    Pc Mael R2 TGGACCAGCTCTCTTTCACGCTTATTTCG
    Pc Pum F1 ATGAACGCAGTGCCTTGGAACGACTCTCAC
    Pc Pum F2 GCAGGACGATGCTATGGTCGGCTATTTC

    01/03/2012

    Regular and first round of RACE with the above primers.

    02/03/2012

    Second round of RACE. Run a gel with only 5 µL of each to identify bands to be cut from RACE and direct purify the products of the regular PCR. Ran another gel with the remaining product to cut the bands*. Extracted promising bands and set the ligation reaction at 22:30.

    • Did not like this procedure. It is better to run the RACE PCR in 10 comb gel with whole 25 µL to get more signal and extract more.

    03/03/2012

    Heat-shock transformation and plating. Also ligation for remaining bands (Mm PIWIL1, Pc Tudor 2,3,4, Pc PUM).

    04/03/2012

    Colony PCR.

    05/03/2012

    Colony PCR for the remaining bands and repetition for some that there was no positive colonies.

    image

    06/03/2012

    Plasmid extraction using 1.5 mL of miniprep culture, sequencing reaction, and dropped at the sequencing facility.

    08/03/12

    Sequences BV25-BV64 returned.

    BV25 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV26 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV27 Membranipora membranacea Mago Nashi T7 ok T7
    BV28 Membranipora membranacea Dicer1 T7 ok + SP6
    BV29 Membranipora membranacea Dicer1 T7 ok + SP6
    BV30 Membranipora membranacea Germ Cell Less R2 T7 ok T7
    BV31 Membranipora membranacea PiwiL1 R2 b2 T7 ok T7
    BV32 Membranipora membranacea PiwiL1 R2 b2 T7 ok + SP6
    BV33 Priapulus caudatus PiwiB R2 b2 T7 ok T7
    BV34 Priapulus caudatus Tudor R2 b1 T7 ok T7
    BV35 Priapulus caudatus Maelstrom F2 T7 ok + SP6
    BV36 Priapulus caudatus Maelstrom F2 T7 ok T7
    BV37 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV38 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV39 Priapulus caudatus Tudor R2 b3 T7 ok T7
    BV40 Priapulus caudatus Tudor R2 b3 T7 ok + SP6
    BV41 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV42 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV43 Priapulus caudatus Pumilio F2 T7 ok + SP6
    BV44 Priapulus caudatus Pumilio F2 T7 ok T7
    BV45 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV46 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV47 Membranipora membranacea Mago Nashi SP6 ok + T7
    BV48 Membranipora membranacea Dicer1 SP6 ok SP6
    BV49 Membranipora membranacea Dicer1 SP6 ok SP6
    BV50 Membranipora membranacea Germ Cell Less R2 SP6 ok + T7
    BV51 Membranipora membranacea PiwiL1 R2 b2 SP6 ok + T7
    BV52 Membranipora membranacea PiwiL1 R2 b2 SP6 ok SP6
    BV53 Priapulus caudatus PiwiB R2 b2 SP6 ok + T7
    BV54 Priapulus caudatus Tudor R2 b1 SP6 ok + T7
    BV55 Priapulus caudatus Maelstrom F2 SP6 ok SP6
    BV56 Priapulus caudatus Maelstrom F2 SP6 ok + T7
    BV57 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV58 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV59 Priapulus caudatus Tudor R2 b3 SP6 ok + T7
    BV60 Priapulus caudatus Tudor R2 b3 SP6 ok SP6
    BV61 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV62 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV63 Priapulus caudatus Pumilio F2 SP6 ok SP6
    BV64 Priapulus caudatus Pumilio F2 SP6 ok + T7

     
  • Bruno Vellutini 17:08 on 2012/02/26 Permalink
    Tags: , , , , pumilio,   

    In situ for Membranipora NANOS, PIWIL2, TDRD1, PUM, MAEL 

    Samples

    • Mm Early: 2-128 cells + day 1 + day 3-4 + late cleavage
    • Mm Late: pre hatch + hatched + day 5 + day 7 + early and late cyphonautes

    26/02/2012 — Day 1

    Samples were put in 2 eppendorfs (early/late) and rehydration, PTw washes and first prehybe carried on there. So between washes there was a gap to wait the embryos to settle.

    On the last step, addition of hybe buffer, samples were aliquot to the following 24-well plate:

    NANOS PIWIL2 MAEL PUM TDRD1
    EARLY
    LATE

    Left overnight at 62 °C at 18h.

    27/02/2012 — Day 2

    Probes were already diluted at the stock concentration 50 ng/µL and I had to dilute MAEL, PUM, and TDRD1 to 1 ng/µL. Hybridization started at 11:30.

    29/02/2012 — Day 4

    Washes with a few modifications (due to busy day):

    • 60 min instead of 30 min at 25% hybe 75% 2X SSC (during Sars Seminar).
    • 3x 10 min 2X SSC at hybe temp.
    • PTw washes reduced to 5 min.
    • PBT washes reduced to 5 min.

    Anti-DIG put at 17:10, rocker at 4 °C.

    01/03/2012 — Day 5

    Regular washes.

    02/03/2012 — Day 6

    Developing started at 12:30 (~450 µL AP substrate solution).

    16:00 — Some signal seems to be appearing in MAEL. Early stages not so conclusive, but on late stages look like a bilateral pattern is emerging in the lateral flanks of the cyphonautes.

    03/03/2012

    16:00 — All five wells with late stages showing cyphonautes with the same bilateral pattern observed above.

    04/03/2012

    Whole day at 4 °C.

     
  • Bruno Vellutini 20:17 on 2012/01/19 Permalink
    Tags: , , , , , , , pumilio,   

    Probe PCR for Membranipora NANOS, PIWIL2, MAEL F2, PUM, TDRD1 

    Clones amplified for riboprobe synthesis:

    Gene ID Probe Kit
    NANOS BV3 SP6
    PIWIL2 BV6 SP6
    MAEL BV9 SP6
    PUM BV21 T7
    TDRD1 BV23 T7

    Probe PCR: 12:00. DNA extraction and purification: 18:30.

    20/01/12

    Agarose gel was ok, products had the expected length.

    Probe Mm 2012-01-20 10hr 20min

    Quantification of PCR product was also ok:

    Sample ng/µl 260/280 260/230
    NANOS 574.73 1.91 1.92
    PIWIL2 480.20 1.94 1.35
    MAEL 300.42 2.05 0.56
    PUM 293.22 2.00 0.53
    TDRD1 224.36 2.00 0.48

    Mm ProbePCR 20.01.12

    Transcription started at 13:30.

     
  • Bruno Vellutini 16:35 on 2012/01/15 Permalink
    Tags: , , , pumilio,   

    MiniPrep for Membranipora MAEL F2, PUM, TUDOR 

    Picked positive colonies to grow. 9 samples on shake to grow at 16:30.

    16/01/12

    Sequencing reaction at 12:00 and tubes dropped by the sequencing facility at 15:00.

    ID Gene Vector Quality Probe Kit
    BV7 MAEL F2 T7  bad  –
    BV8 MAEL F2 T7  ok  SP6
    BV9 MAEL F2 T7  ok  SP6
    BV10 PUM T7  ok  SP6
    BV11 PUM T7  ok  T7
    BV12 PUM T7  ok  T7
    BV13 TUDOR T7  ok  T7
    BV14 TUDOR T7  ok  T7
    BV15 TUDOR T7  ok  T7
    BV16 MAEL F2 SP6  bad  –
    BV17 MAEL F2 SP6  ok  SP6
    BV18 MAEL F2 SP6  ok  SP6
    BV19 PUM SP6  ok  SP6
    BV20 PUM SP6  ok  T7
    BV21 PUM SP6  ok  T7
    BV22 TUDOR SP6  ok  T7
    BV23 TUDOR SP6  ok  T7
    BV24 TUDOR SP6  ok  T7

    19/01/12

    Sequences came back.

     
  • Bruno Vellutini 21:59 on 2012/01/11 Permalink
    Tags: , , , , pumilio,   

    Debugging PCRs with Bn PUM1 F2, Mm MAEL F2, Mm PUM, Mm TDRD1 

    11/01/12

    RACE PCR: Bn PUM1 F2, Mm MAEL F2

    PCR: Mm PUM, Mm TDRD1

    BnMmPCRs 2012-01-11 19hr 04min

    I cut the bands from the RACE PCR very quickly under UV light (<10s each) and purified regular PCR directly (band was not cut from the gel). This is to be sure that exposure to UV is not damaging the samples, which could be responsible for the ligation failures.

    Standard ligation set up at 21:00 (protocol values).

    12/01/12

    Heat shock transformation and plating at 17:30, looking good.

    13/01/12

    Bn PUM1 F2 and Mm MAEL F2 did not have many colonies (6 and 3, respectively). The latter could be because of the amount of PCR product interfering in the ligation. Mm PUM and Mm TDRD1 had extra colonies and I included 6 of each in the colony check PCR, started at 10:50.

    MmColony 2012-01-13 15hr 17min

    Positive colonies! Looks like purifying PCR product directly is more worth it, if there is only one band. Apparently the UV was indeed damaging the DNA from the samples. Asterisks marks are colonies to be picked for the MiniPreps.

    Bn PUM1 F2 No positive colonies, only a 500 bp one.
    Mm MAEL F2 Positive: 1, 2, 3
    Mm PUM Positive: 3, 4, 6
    Mm TUDOR Positive: 3, 4, 5 (2 also, but bit shorter)

    15/01/12

    Add 3 mL of LB to MiniPrep tubes and leave in the shaker.

     
  • Bruno Vellutini 18:00 on 2012/01/11 Permalink
    Tags: , , , pumilio,   

    Extra heat shock transformation 

    11/01/12

    I did an additional heat shock transformation using new Aina’s newest cells and the most recent ligation. Used the following samples Bn PUM1 F2, Mm MAEL F2, Mm PUM, Mm TDRD1, Control 1 (1.5 µl of ligation mix, what was left) and plated at 17:00.

    12/01/12

    Not enough colonies.

     
  • Bruno Vellutini 11:37 on 2012/01/09 Permalink
    Tags: , , , , , , pumilio, ,   

    New ligation/transformation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1 

    08/01/12

    Set a new ligation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1; + 2 control tubes using the same amount (1.5 µl) of the control DNA insert.

    09/01/12

    Transformation using 3 µl of ligation per tube, except for Control 2 where I added 5 µl of ligation. Plated with 400 µl and waited plates to be completely dry to incubate at 37 °C at 19:00.

    NanoDrop

    Chema suggested to quantify the amount of DNA in the PCR products to be able to calculate the quantity to be used in the ligation reaction. To do this I used NanoDrop spectophotometer.

    Bn PUM1 F2 Mm MAEL F2 Mm DDX4 R2 Mm PIWIL1 R1 Mm PUM Mm TDRD1
    260/280 2.54 2.02 1.87 0.63 2.12 2.21
    260/230 0.77 1.47 0.29 -0.02 0.79 0.41
    ng/µl 56.3 207.7 24.0 -6.2 62.6 64.3

    260/280: ratio of sample absorbance at 260 and 280 nm. The ratio of absorbance at 260 and 280 nm is used to assess the purity of DNA and RNA. A ratio of ~1.8 is generally accepted as “pure” for DNA; a ratio of ~2.0 is generally accepted as “pure” for RNA. If the ratio is appreciably lower in either case, it may indicate the presence of protein, phenol or other contaminants that absorb strongly at or near 280 nm.

    260/230: ratio of sample absorbance at 260 and 230 nm. This is a secondary measure of nucleic acid purity. The 260/230 values for “pure” nucleic acid are often higher than the respective 260/280 values. They are commonly in the range of 1.8-2.2. If the ratio is appreciably lower, this may indicate the presence of co-purified contaminants.

    ng/uL: sample concentration in ng/uL based on absorbance at 260 nm and the selected analysis constant.

    From NanoDrop User Guide.

    According to Aina, the contamination at the 260/230 is from the extraction buffer and should not interfere with the ligation.

    10/01/12

    Colony growth was better this time, but I still should be getting more colonies than now for some samples. Increase in colony number might be due to the plating amount (400 µl) or even the 1 µL increase in the PCR product for the ligation.

    Gene Colonies Picked
    Bn PUM1 F2 ~10 6
    Mm MAEL F2 3 3
    Mm DDX4 R2 Many 6
    Mm Piwil1 R1 5 5
    Mm PUM ~15 6
    Mm TDRD1 ~10 6
    Control 1 7 5
    Control 2 Many 5

    Colony checking PCR started at 14:00.

    11/01/12

    No positive colonies… Repeat.

    Ms_Colony2_110112MmColony 2012-01-11 12hr 23min

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel