Tagged: primers Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 12:22 on 2013/03/06 Permalink
    Tags: , primers   

    Checked in new primers for Meara RNA binding proteins. Let the cloning begin!

     
  • Bruno Vellutini 15:19 on 2012/05/24 Permalink
    Tags: , , , , primers, , , ,   

    Primers for more Terebratalia germline genes have arrived.

    • Tt dicer1b
    • Tt runx2
    • Tt maelstrom
    • Tt tudor1
    • Tt pl10
    • Tt ago
    • Tt pum
     
  • Bruno Vellutini 12:30 on 2012/04/26 Permalink
    Tags: , , primers,   

    Primers Tt en, Tt dlx, and Mm six3/6 just arrived.

     
  • Bruno Vellutini 11:56 on 2012/03/22 Permalink
    Tags: , , , , otp, , primers,   

    Membranipora primers have arrived: Mm Syt1a, Syt1b, NK2.1, FoxG, Otp, PL10, Fez.

     
  • Bruno Vellutini 18:10 on 2011/12/01 Permalink
    Tags: , , , primers, , ,   

    Membranipora membranacea germline BLASTing 

    Candidate genes related to germline development were batch BLASTed against the transcriptome of Membranipora membranacea (unpublished) using the new BLASTer script. Six genes yield transcriptome alignments, Piwi, Pumilio, Vasa, Nanos, Maelstron, and Tudor. Here are the reverse BLAST (Membranipora sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

    Locus_4048_Transcript_4/4_Confidence_0.500_Length_3410		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		0.00e+00 <<
    	PIWIL2		55124		NP_001129193.1		0.00e+00 <<
    	PIWIL2		55124		NP_060538.2		0.00e+00
    	PIWIL1		9271		NP_001177900.1		2.06e-174
    	PIWIL4		143689		NP_689644.2		8.72e-157
    
    Locus_2928_Transcript_3/3_Confidence_0.750_Length_1492		(candidates: NANOS1, NANOS2)
    	gene		id		accession		e-value
    	NANOS1		340719		NP_955631.1		8.63e-20 <<
    	NANOS2		339345		NP_001025032.1		4.73e-18 <<
    	NANOS3		342977		NP_001092092.1		9.87e-16
    
    Locus_978_Transcript_1/1_Confidence_1.000_Length_2580		(candidates: DDX4)
    	gene		id		accession		e-value
    	DDX4		54514		NP_001160005.1		3.78e-141
    	DDX4		54514		NP_001136021.1		3.78e-141
    	DDX4		54514		NP_077726.1		3.78e-141 <<
    	DDX4		54514		NP_001160006.1		4.93e-141
    	DDX3X		1654		NP_001180346.1		7.40e-121
    	DDX3X		1654		NP_001347.3		7.40e-121
    	DDX3X		1654		NP_001180345.1		7.40e-121
    
    Locus_854_Transcript_1/2_Confidence_1.000_Length_3272		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		0.00e+00 <<
    	PIWIL1		9271		NP_001177900.1		0.00e+00
    	PIWIL4		143689		NP_689644.2		0.00e+00
    	PIWIL2		55124		NP_001129193.1		0.00e+00 <<
    	PIWIL2		55124		NP_060538.2		0.00e+00
    
    Locus_12836_Transcript_1/1_Confidence_1.000_Length_1641		(candidates: MAEL)
    	gene		id		accession		e-value
    	MAEL		84944		NP_116247.1		2.16e-27 <<
    
    Locus_1952_Transcript_9/9_Confidence_0.474_Length_5369		(candidates: PUM2, PUM1)
    	gene		id		accession		e-value
    	PUM1		9698		NP_055491.1		1.15e-166
    	PUM1		9698		NP_055491.1		2.87e-08
    	PUM1		9698		NP_001018494.1		7.47e-166 <<
    	PUM1		9698		NP_001018494.1		2.87e-08 <<
    	PUM2		23369		NP_056132.1		9.75e-166 <<
    
    Locus_3478_Transcript_2/3_Confidence_0.667_Length_6149		(candidates: TDRD1)
    	gene		id		accession		e-value
    	TDRD1		56165		NP_942090.1		9.56e-32 <<
    	TDRD1		56165		NP_942090.1		9.26e-27 <<
    	TDRD1		56165		NP_942090.1		1.93e-24 <<
    	TDRD1		56165		NP_942090.1		5.44e-19 <<
    	TDRD1		56165		NP_942090.1		2.07e-18 <<
    	TDRD1		56165		NP_942090.1		6.44e-12 <<
    	TDRD1		56165		NP_942090.1		1.10e-11 <<
    	TDRD1		56165		NP_942090.1		1.59e-10 <<
    	TDRD1		56165		NP_942090.1		6.03e-10 <<
    	TDRD1		56165		NP_942090.1		4.32e-08 <<
    	TDRD1		56165		NP_942090.1		2.80e-07 <<
    	TDRD1		56165		NP_942090.1		8.15e-07 <<
    	TDRD1		56165		NP_942090.1		4.47e-05 <<

    Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

    Primers

    PIWIL2

    Whole sequence available, regular primer pairs.

    Mm PIWIL2 F    1341-1364    5'- CCACGGTAACAGAATGGAAAGTTC -3'
                                   24 nt forward primer
                                   pct G+C:   45.8 Tm:   55.7
    
    Mm PIWIL2 R    2354-2331    5'- ACGACCACATAATGGGTAGGTGTC -3'
                                   24 nt backward primer
                                   pct G+C:   50.0 Tm:   55.7
    
                   1014 nt product for F2-B2 pair (1341-2354)
                   Optimal annealing temp:   56.8
                   pct G+C:   46.9          Tm:   78.5

    PIWIL1

    Beginning not available, need 5′ RACE primer.

    Mm PIWIL1 R1    2080-2055    5'- CCGTTGTTGACCTGATGCCACTTTCG -3'
    	                        26 nt primer on minus strand
    	                        pct G+C:   53.8 	Tm:   72.9
    Mm PIWIL1 R2     128-99      5'- ACGATGTGATGCTCTCCCTGCTCCATTACC -3'
    	                        30 nt primer on minus strand
    	                        pct G+C:   53.3 	Tm:   74.3

    DDX4

    Only 5′ RACE primer.

    Mm DDX4 R1     831-803     5'- TCTCTGTGTCTTGTCTGGCATACCCATCG -3'
    	                      29 nt primer on minus strand
    	                      pct G+C:   51.7 	Tm:   72.5
    Mm DDX4 R2      64-35      5'- CAGTCACCTTTCTCGGGTTTGGACACTCTC -3'
    	                      30 nt primer on minus strand
    	                      pct G+C:   53.3 	Tm:   72.8

    NANOS

    Primer pair.

    Mm NANOS F    111-134     5'- CTCTTGGATTTGTGCTATTGGGAC -3'
    	                     24 nt forward primer
    	                     pct G+C:   45.8 	Tm:   55.8
    
    Mm NANOS R     978-954     5'- CAGTGTGTAGGATGTGTTGACGAAG -3'
    	                      25 nt backward primer
    	                      pct G+C:   48.0 	Tm:   55.3
    
    	                 868 nt product for F1-B1 pair (111-978)
    	                 Optimal annealing temp:   56.3
    	                 pct G+C:   46.0          	Tm:   78.0

    MAEL

    Needs both RACE primers.

    Mm MAEL F1    796-824     5'- TGTATGAGTTGGAGTCGCTGTTCTGTGCC -3'
    	                     29 nt primer on plus strand
    	                     pct G+C:   51.7 	Tm:   72.5
    Mm MAEL F2    832-859     5'- ACCATAGCGGTAAAGGAATGCCCCCAAG -3'
    	                     28 nt primer on plus strand
    	                     pct G+C:   53.6 	Tm:   73.5
    
    Mm MAEL R1     537-509     5'- CGCCAGGTTTGAGGAACTGATGATAGCAC -3'
    	                      29 nt primer on minus strand
    	                      pct G+C:   51.7 	Tm:   72.5
    Mm MAEL R2     161-132     5'- ATCAGCCATACCTCCAGGGAATACACGACC -3'
    	                      30 nt primer on minus strand
    	                      pct G+C:   53.3 	Tm:   73.1

    PUM

    Whole gene.

    First option in the conserved domain and lower G+C
    Mm PUM F   3251-3275    5'- CGAAGAAGTATGCTCTGTCACCGAG -3'
    	                   25 nt forward primer
    	                   pct G+C:   52.0 	Tm:   58.2
    
    Mm PUM R    4621-4598    5'- CTCAATGCCTGAAGGGAAAGTAGG -3'
    	                    24 nt backward primer
    	                    pct G+C:   50.0 	Tm:   57.2
    
    	                 1371 nt product for F3-B6 pair (3251-4621)
    	                 Optimal annealing temp:   54.8
    	                 pct G+C:   38.2          	Tm:   75.1

    TDRD1

    5′ end not present, but conserved domains present.

    Mm TDRD1 F   1504-1527    5'- CATAGCAAAGTTCAAGGACGATGG -3'
    	                     24 nt forward primer
    	                     pct G+C:   45.8 	Tm:   56.7
    
    Mm TDRD1 R    2583-2560    5'- ACCTGGGCTGTCACACTCTCTAAC -3'
    	                      24 nt backward primer
    	                      pct G+C:   54.2 	Tm:   55.4
    
    	                 1080 nt product for F1-B1 pair (1504-2583)
    	                 Optimal annealing temp:   56.2
    	                 pct G+C:   45.3          	Tm:   77.8
     
  • Bruno Vellutini 18:00 on 2011/12/01 Permalink
    Tags: , , , , primers,   

    Bugula neritina germline BLASTing 

    Candidate genes related to germline development were batch BLASTed against the transcriptome of Bugula neritina using the new BLASTer script. Only 2 genes yield transcriptome alignments, Piwi and Pumilio. Here are the reverse BLAST (Bugula sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

    gnl|SRA|SRR034781.65778.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_060538.2		2.45e-29
    	PIWIL2		55124		NP_060538.2		2.45e-29
    
    gnl|SRA|SRR034781.74499.2		(candidates: PIWIL2)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.21e-33
    	PIWIL3		440822		NP_001008496.2		8.22e-29
    	PIWIL4		143689		NP_689644.2		2.39e-28
    	PIWIL2		55124		NP_001129193.1		1.31e-26 <<
    	PIWIL2		55124		NP_060538.2		1.31e-26
    
    gnl|SRA|SRR034781.49286.2		(candidates: PUM2, PUM1)
    	gene		id		accession		e-value
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		3.43e-11 <<
    	PUM1		9698		NP_001018494.1		1.22e-08 <<
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		2.62e-11
    	PUM1		9698		NP_055491.1		1.10e-09
    
    gnl|SRA|SRR034781.80037.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.61e-32 <<
    	PIWIL3		440822		NP_001008496.2		5.27e-28
    	PIWIL4		143689		NP_689644.2		2.00e-27
    	PIWIL2		55124		NP_001129193.1		8.42e-26 <<
    	PIWIL2		55124		NP_060538.2		8.42e-26

    Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

    Obs: low number of hits may be due to the quality of the transcriptome assembly, sequences seem to be short.

    Primers

    PUM1

    5′ and 3′ RACE primers needed

    Bn PUM1 F1    48-77      5'- CCAGACCAGACGGATGTGATTCTCTCAGAG -3'
    	                    30 nt primer on plus strand
    	                    pct G+C:   53.3 	Tm:   72.4
    Bn PUM1 F2    136-164    5'- ACGTGCTGGAACACGGTAGACTGGAGGAG -3'
    	                    29 nt primer on plus strand
    	                    pct G+C:   58.6 	Tm:   74.1
    
    Bn PUM1 R1    456-429    5'- ACTTCCTCAGTGTAGAAACATGGGGGCG -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   72.1
    Bn PUM1 R2    120-93     5'- TGCCATACTGATCCATCACCAGTCGGTC -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   73.3

    PIWIL1

    Only 5′ RACE primers needed.

    Bn PIWIL1 R1             5'- AACTGCCCATCTCCAACTCCATCACGGTAG -3'
    Bn PIWIL1 R2             5'- TTAGGGAAGCCACAAAACCACCGACAG -3'
     
  • Bruno Vellutini 18:30 on 2011/11/29 Permalink
    Tags: , primers,   

    Design of oligonucleotide primers 

    Background and advice for designing primers, taken from the same book as the previous post.

    • Specificity is crucial; the longer, the higher specificity.
    • Probability: K = [g/2]^G+C x [(1-g)/2]^A+T — K is expected frequency, g is relative G+C content, GCAT number of each nucleotide.
    • 15 nucleotides would be unique within 3×10⁹ genome, but due to bias in codon usage, repetitive DNA sequences and gene families, they are not.
    • Good idea to scan DNA databases to see if only the wanted sequence is returned.

    Selecting primers

    • Analysis: free of homopolymeric tracts, no secundary structures, not self-complimentary, no significant homology with other sequences.
    • List possible forward/reverse primers with calculating the melting point.
    • Selection of well-matched primers: similar in G+C content, but no more than 3 consecutive nucleotides should be complementary.
    • Refine length and placement of oligonucleotides: 3′-terminal nucleotide is G or C.

    Primer design properties

    Base composition

    • G+C between 40-60%.
    • Even distributions of all four bases along the length of the primer.

    Length

    • Complementary region should be 18-25 nucleotides.
    • Primer pair should not differ by >3bp.

    Repeated and self complementary sequences

    • Inverted or self complementary should not be >3bp in length.
    • Tend to form hairpins and obstruct the annealing.

    Complementary between primer pair

    • 3′ terminal should not bind to any site of the other one.
    • Hybrids formation will compete with the expected amplification.

    Melting temperature

    • Temperature of primers (in pair) should not differ by >5°C.
    • Temperature of amplified product should not differ >10°C.
    • Ensures that denaturation occurs in each cycle.

    3′ termini

    • Crucially should end with G or C.
    • However, GC or CG are not recommended since it increases the probability of forming hairpins.

    Adding sequences to 5′ termini

    • Restriction sites, bacteriophage promoters, etc, commonly added to 5′ end.
    • Does not affect annealing.

    Placement of priming sites

    • Maybe constrained by the location of mutations, restriction sites ,coding sequences, microsatellites, cis-acting elements.
    • When for cDNA best to use sequences that bind to different exons, so that contaminating genomic DNA is easily distinguished.

    Primers for degenerate PCR

    • If short sequence aminoacid only, a pool of degenerate oligonucleotides containing all possible coding combinations can be used to amplify.
     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel