Tagged: piwi Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 18:00 on 2012/04/30 Permalink
    Tags: , , , piwi, , ,   

    Probe synthesis for Mm Vasa, Nanos, Piwi1, Piwi2 and Tt Vasa, Nanos, Piwib 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Running a probe PCR for germ line genes of Membranipora (again) and Terebratalia (see table below). Setup is the same as a colony PCR, but doubling the amount (50µL) and using 3 µL of plasmid DNA. I extracted the bands and purified the DNA.

    Membranipora probe pcr for nanos, piwi2, vasa, and piwi1Terebratalia probe pcr for vasa, nanos, and piwib

    01/05/12

    This is the gel with the purified yield and the nanodrop measures.
    Purified dna from probe pcr of Mm and Tt germ genes

    02/05/12

    Transcription reaction initiated at 11h, tubes put in the cycler using incubate function at 37 °C.

    03/05/12

    Finished the probe synthesis and stored in hybe buffer diluted 50 ng/µL.

    Probe specs
    ID Gene Probe Kit Probe PCR ng/µL  Probe ng/µL
    BV3 MmNanos SP6 881.0 1283.41
    BV6 MmPiwi2 SP6 745.1 1149.77
    BV91 MmVasa SP6 586.9 477.97
    BV94 MmPiwi1 SP6 571.3 902.3
    BV96 TtVasa SP6 517.8 572.53
    BV100 TtNanos SP6 582.4 1158.87
    BV103 TtPiwib SP6 651.8 493.36

     
  • Bruno Vellutini 12:00 on 2012/04/29 Permalink
    Tags: , , , , piwi, ,   

    Abstract submitted to EuroEvoDevo 2012 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Germ cell development in non-spiralian lophotrochozoans: insights from a bryozoan and a brachiopod

    Bryozoa and Brachiopoda are two spiralian taxa that, unlike other spiralians, undergo non-spiral cleavage and have unique non-trochophore larvae. Previous morphological studies determined that no distinctive germline is formed during embryonic development and that germ cells first appear relatively late in larval life or after metamorphosis. These observations suggest that the specification of primordial germ cells occurs by late inductive signaling (epigenesis) rather than inheritance of maternal determinants (preformation). The molecular mechanisms involved in germ cell formation in bryozoans and brachiopods are currently unknown. We have therefore used RNASeq data to identify and then clone the conserved germline-specific genes vasa, nanos, and piwi from the bryozoan Membranipora membranacea and the brachiopod Terebratalia transversa. In situ hybridization shows that Mm-nanos transcripts are not detected in the blastomeres during early cleavage, but are localized posteriorly in the internal sac region of the late-gastrula stage and early cyphonautes larvae of M. membranacea. In addition, Mm-piwi2 mRNA is present in the cytoplasm of M. membranacea blastomeres and is broadly expressed in the larval tissues, except for the corona and apical organ. Our preliminary results suggest that the signaling related to the differentiation of bryozoan germ cells may be established earlier in ontogeny than previously thought, possibly during gastrulation. A thorough analysis of the expression patterns will provide clues for understanding the regulatory mechanisms of pluripotent and germ cell development in bryozoans and brachiopods and offer further insights about the developmental diversity of spiralians.

     
  • Bruno Vellutini 16:05 on 2012/04/23 Permalink
    Tags: , , , piwi, ,   

    Colony PCR Membranipora Vasa and PiwiL1 and Terebratalia Vasa, Nanos, and Piwis 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Colony PCR with the selected genes from the previous batch of heat shock transformations.

     
  • Bruno Vellutini 18:00 on 2012/04/18 Permalink
    Tags: , , , , piwi, , , ,   

    Cloning Membranipora and Terebratalia piwi, nanos, vasa, hedgehog, smoothened, runx 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Running a PCR overnight to clone the following genes:

    Mm: Piwi1, Vasa, Runx
    Tt: Hedgehog, Smoothened, Piwia, Piwib, Vasa, Nanos.

    First time cloning Terebratalia genes.

    19/04/12

    Membranipora bands were ok and were purified directly (and ligated), but Terebratalia were too faint:

    For this reason I ran a re-PCR for Terebratalia genes.

    20/04/12

    For the re-PCR I diluted the PCR product of the first reaction 1:20 and used as a template for a regular PCR (without changing any parameters). The bands this time were stronger, except for Piwia. Since unwanted bands appeared I had to cut the gel, extract, and purify the DNA.

    Ligation was also set for these genes.

    21/04/12

    Heat shock transformation for all genes.

     
  • Bruno Vellutini 18:00 on 2012/03/23 Permalink
    Tags: , , , , piwi, ,   

    In situ Membranipora nanos, piwi2, maelstrom, pumilio, tudor 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Treated the samples for 1 min in proteinase-k, and then 2 washes in glycine. Put in prehybe at 20:00.

    25/03/12

    Started hybridization at 14:00.

    27/03/12

    Regular washes.

    29/03/12

    Developing from 11:30.

    Summary

    In the last days there were no embryos left (only some cyphonautes shells). The 1 min prot-k treatment with regular 5 min washes in glycine seems to be too much for them. Also, the longer period in prehybe possibly was not nice either.

     
  • Bruno Vellutini 10:00 on 2012/03/01 Permalink
    Tags: , , , , piwi, , , ,   

    PCRs for new Membranipora and Priapulus primers 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Cloning newly collected genes of Membranipora and Priapulus. Selected genes and primers:

    Membranipora:

    Mm PIWIL1 R1 CCGTTGTTGACCTGATGCCACTTTCG
    Mm PIWIL1 R2 ACGATGTGATGCTCTCCCTGCTCCATTACC
    Mm DDX4 R1 TCTCTGTGTCTTGTCTGGCATACCCATCG
    Mm DDX4 R2 CAGTCACCTTTCTCGGGTTTGGACACTCTC
    Mm AGO2 F CTTCGCACCTCAGAGGGTAG
    Mm AGO2 R CTGGCCCTGAAAGCTACAAG
    Mm MEX3 F CCAGTGAGAGGAGCTGAACC
    Mm MEX3 R CATCACCACCACACAAGAGG
    Mm MAGOH F TCCGCCATTCTTTCTCTTTG
    Mm MAGOH R TGGTTGAATGCAAGATGGAA

    Priapulus:

    Pc PiwiA F GGGTCTTATTCTTTGTTTGC
    Pc PiwiA R TTCACGACACCATCGCAG
    Pc PiwiB R1 TGCGATACTGCCGACCATCTTCTTGTCC
    Pc PiwiB R2 ACGGGATGTGATGGGCTGTAACCTTTCG
    Pc Tudor R1 TCCACAAAATAGTAGGCAAGGCAAGGGCTC
    Pc Tudor R2 ACGCAACAGATGAACACCTCTACGGCTTGG
    Pc Mael F1 CGTGAAAGAGAGCTGGTCCAGTCAGAATGG
    Pc Mael F2 CACCGCTTCATAGCTCCAGGTGAAATCC
    Pc Mael R1 GCGGTGAAATTCCCTCATAATGCCCTTCTC
    Pc Mael R2 TGGACCAGCTCTCTTTCACGCTTATTTCG
    Pc Pum F1 ATGAACGCAGTGCCTTGGAACGACTCTCAC
    Pc Pum F2 GCAGGACGATGCTATGGTCGGCTATTTC

    01/03/2012

    Regular and first round of RACE with the above primers.

    02/03/2012

    Second round of RACE. Run a gel with only 5 µL of each to identify bands to be cut from RACE and direct purify the products of the regular PCR. Ran another gel with the remaining product to cut the bands*. Extracted promising bands and set the ligation reaction at 22:30.

    • Did not like this procedure. It is better to run the RACE PCR in 10 comb gel with whole 25 µL to get more signal and extract more.

    03/03/2012

    Heat-shock transformation and plating. Also ligation for remaining bands (Mm PIWIL1, Pc Tudor 2,3,4, Pc PUM).

    04/03/2012

    Colony PCR.

    05/03/2012

    Colony PCR for the remaining bands and repetition for some that there was no positive colonies.

    image

    06/03/2012

    Plasmid extraction using 1.5 mL of miniprep culture, sequencing reaction, and dropped at the sequencing facility.

    08/03/12

    Sequences BV25-BV64 returned.

    BV25 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV26 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV27 Membranipora membranacea Mago Nashi T7 ok T7
    BV28 Membranipora membranacea Dicer1 T7 ok + SP6
    BV29 Membranipora membranacea Dicer1 T7 ok + SP6
    BV30 Membranipora membranacea Germ Cell Less R2 T7 ok T7
    BV31 Membranipora membranacea PiwiL1 R2 b2 T7 ok T7
    BV32 Membranipora membranacea PiwiL1 R2 b2 T7 ok + SP6
    BV33 Priapulus caudatus PiwiB R2 b2 T7 ok T7
    BV34 Priapulus caudatus Tudor R2 b1 T7 ok T7
    BV35 Priapulus caudatus Maelstrom F2 T7 ok + SP6
    BV36 Priapulus caudatus Maelstrom F2 T7 ok T7
    BV37 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV38 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV39 Priapulus caudatus Tudor R2 b3 T7 ok T7
    BV40 Priapulus caudatus Tudor R2 b3 T7 ok + SP6
    BV41 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV42 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV43 Priapulus caudatus Pumilio F2 T7 ok + SP6
    BV44 Priapulus caudatus Pumilio F2 T7 ok T7
    BV45 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV46 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV47 Membranipora membranacea Mago Nashi SP6 ok + T7
    BV48 Membranipora membranacea Dicer1 SP6 ok SP6
    BV49 Membranipora membranacea Dicer1 SP6 ok SP6
    BV50 Membranipora membranacea Germ Cell Less R2 SP6 ok + T7
    BV51 Membranipora membranacea PiwiL1 R2 b2 SP6 ok + T7
    BV52 Membranipora membranacea PiwiL1 R2 b2 SP6 ok SP6
    BV53 Priapulus caudatus PiwiB R2 b2 SP6 ok + T7
    BV54 Priapulus caudatus Tudor R2 b1 SP6 ok + T7
    BV55 Priapulus caudatus Maelstrom F2 SP6 ok SP6
    BV56 Priapulus caudatus Maelstrom F2 SP6 ok + T7
    BV57 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV58 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV59 Priapulus caudatus Tudor R2 b3 SP6 ok + T7
    BV60 Priapulus caudatus Tudor R2 b3 SP6 ok SP6
    BV61 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV62 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV63 Priapulus caudatus Pumilio F2 SP6 ok SP6
    BV64 Priapulus caudatus Pumilio F2 SP6 ok + T7

     
  • Bruno Vellutini 17:08 on 2012/02/26 Permalink
    Tags: , , , piwi, ,   

    In situ for Membranipora NANOS, PIWIL2, TDRD1, PUM, MAEL 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Samples

    • Mm Early: 2-128 cells + day 1 + day 3-4 + late cleavage
    • Mm Late: pre hatch + hatched + day 5 + day 7 + early and late cyphonautes

    26/02/2012 — Day 1

    Samples were put in 2 eppendorfs (early/late) and rehydration, PTw washes and first prehybe carried on there. So between washes there was a gap to wait the embryos to settle.

    On the last step, addition of hybe buffer, samples were aliquot to the following 24-well plate:

    NANOS PIWIL2 MAEL PUM TDRD1
    EARLY
    LATE

    Left overnight at 62 °C at 18h.

    27/02/2012 — Day 2

    Probes were already diluted at the stock concentration 50 ng/µL and I had to dilute MAEL, PUM, and TDRD1 to 1 ng/µL. Hybridization started at 11:30.

    29/02/2012 — Day 4

    Washes with a few modifications (due to busy day):

    • 60 min instead of 30 min at 25% hybe 75% 2X SSC (during Sars Seminar).
    • 3x 10 min 2X SSC at hybe temp.
    • PTw washes reduced to 5 min.
    • PBT washes reduced to 5 min.

    Anti-DIG put at 17:10, rocker at 4 °C.

    01/03/2012 — Day 5

    Regular washes.

    02/03/2012 — Day 6

    Developing started at 12:30 (~450 µL AP substrate solution).

    16:00 — Some signal seems to be appearing in MAEL. Early stages not so conclusive, but on late stages look like a bilateral pattern is emerging in the lateral flanks of the cyphonautes.

    03/03/2012

    16:00 — All five wells with late stages showing cyphonautes with the same bilateral pattern observed above.

    04/03/2012

    Whole day at 4 °C.

     
  • Bruno Vellutini 20:51 on 2012/01/20 Permalink
    Tags: , , , piwi   

    Membranipora NANOS and PIWIL2 in situ 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    20/01/12

    Day 1…

     
  • Bruno Vellutini 20:17 on 2012/01/19 Permalink
    Tags: , , , , , piwi, , ,   

    Probe PCR for Membranipora NANOS, PIWIL2, MAEL F2, PUM, TDRD1 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Clones amplified for riboprobe synthesis:

    Gene ID Probe Kit
    NANOS BV3 SP6
    PIWIL2 BV6 SP6
    MAEL BV9 SP6
    PUM BV21 T7
    TDRD1 BV23 T7

    Probe PCR: 12:00. DNA extraction and purification: 18:30.

    20/01/12

    Agarose gel was ok, products had the expected length.

    Probe Mm 2012-01-20 10hr 20min

    Quantification of PCR product was also ok:

    Sample ng/µl 260/280 260/230
    NANOS 574.73 1.91 1.92
    PIWIL2 480.20 1.94 1.35
    MAEL 300.42 2.05 0.56
    PUM 293.22 2.00 0.53
    TDRD1 224.36 2.00 0.48

    Mm ProbePCR 20.01.12

    Transcription started at 13:30.

     
  • Bruno Vellutini 16:49 on 2012/01/09 Permalink
    Tags: , , , piwi   

    MiniPrep for Membranipora PIWIL2 and NANOS 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    09/01/12

    Two positive colonies form Mm PIWIL2 (1 and 3) and Mm NANOS (2 and 3) were picked and added to a growth tube with 3 mL of LB medium. Tubes were left in the S8 large shaker overnight at 210 rpm / 37 °C.

    10/01/12

    1.5 mL were poured to eppendorfs, centrifuged, discarded supernatant and followed the MiniPrep protocol. DNA was kept in the fridge overnight before the sequencing reaction.

    11/01/12

    PCR sequencing reaction and submitted samples:

    ID Gene Primer Quality Probe Kit
    BV1 PIWIL2 T7 bad
    BV2 PIWIL2 T7 bad
    BV3 NANOS T7 ok SP6
    BV4 NANOS T7 ok SP6
    BV5 PIWIL2 SP6 bad
    BV6 PIWIL2 SP6 short, ok SP6

    13/01/12

    Sequences came back, see above.

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel