Tagged: mex Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 17:10 on 2013/03/25 Permalink
    Tags: , , , , mex, , ,   

    Cloning of Terebratalia wnt2 and other Meara RNA binding proteins 

    Started a PCR with Terebratalia wnta, wnt2; and Meara ago a, ago b, ago c, bru a, bru b, mago, mex3, orb2.

    2013-03-26 11.47.59 2013-03-28 15.23.26

    12/04/13

    Put colonies to grow.

    Colony T7
    Ago a c1 BV235
    Ago a c2 BV236
    Ago a c3 BV237
    Ago b c1 BV238
    Ago b c2 BV239
    Ago b c4 BV240
    Bru a c1 BV241
    Bru a c2 BV242
    Bru a c3 BV243
    Mago c1 BV244
    Mago c2 BV245
    Mago c3 BV246
    Orb2 c1 BV247

     
  • Bruno Vellutini 14:36 on 2013/03/08 Permalink
    Tags: , , , , , , , mex, ,   

    Cloning of Meara RNA binding proteins 

    Initial cloning of Meara RNA binding proteins. Selection: ago a, ago b, ago c, boule, bru a, bru b, gus a, mago, mex3, orb2, stau.

    10/03/13

    Only 3 genes had visible bands: boule, gus a, and stau:

    2013-03-10 17.12.53

    Ligated these overnight.

    11/03/13

    Transformation and plated the genes.

    12/03/13

    Colony PCR with 6 colonies from each:

    2013-03-12 16.58.53

    14/03/13

    Put colonies to grow.

    boule c1 BV226 BV229
    boule c2 BV227 BV230
    boule c3 BV228 BV231
    gus a c1 BV229 BV226
    gus a c2 BV230 BV227
    gus a c3 BV231 BV228
    stau c1 BV232
    stau c2 BV233
    stau c3 BV234

    15/03/13

    Extracted plasmid and did sequencing PCR for all using T7 primer. Dropped tubes into sequencing facility.

    26/03/13

    Checking sequences and they look good, but there is a problem! Minipreps BV226, 227, 228 aligned with gus a and not with boule!!! Check why…

    Screen Shot 2013-03-26 at 10.22.12 AM

     
  • Bruno Vellutini 23:50 on 2012/04/01 Permalink
    Tags: , , , mex, , ,   

    More Membranipora genes: Mex3, Fez, PL10, FoxG, Syt1a, Syt1b 

    Set a PCR to clone: Mex3, Fez, PL10, FoxG, Syt1a, Syt1b

    02/04/12

    Bands with expected lengths. Purified DNA, set ligation reaction for 1h45 at RT, heatshock transformation and plated colonies with Xgal.

    03/04/12

    Plates were wetty, so colonies did not spread well… some were forming strings; but enough to pick. Picked white colonies for colony PCR:

    09/04/12

    Sequencing PCR and dropped in the SeqLab.

    BV75 Membranipora membranacea Mex3 T7
    BV76 Membranipora membranacea Fez T7
    BV77 Membranipora membranacea Fez T7
    BV78 Membranipora membranacea Fez T7
    BV79 Membranipora membranacea PL10 T7
    BV80 Membranipora membranacea PL10 T7
    BV81 Membranipora membranacea PL10 T7
    BV82 Membranipora membranacea FoxG T7
    BV83 Membranipora membranacea FoxG T7
    BV84 Membranipora membranacea FoxG T7
    BV85 Membranipora membranacea Syt1a T7
    BV86 Membranipora membranacea Syt1a T7
    BV87 Membranipora membranacea Syt1a T7
    BV88 Membranipora membranacea Syt1b T7
    BV89 Membranipora membranacea Syt1b T7
    BV90 Membranipora membranacea Syt1b T7

     
  • Bruno Vellutini 18:04 on 2012/03/20 Permalink
    Tags: mex, ,   

    Colony screening for Mm DDX4 and MEX3 

    I picked 19 colonies from the previous PCRs of Mm DDX4 and Mm MEX3. Trying to find a positive colony, specially for Vasa.

    No positive colonies for MEX3. For Vasa the length was not the same as expected, but I will sequence 6, 7, 10, 15, 17 to check.

     
  • Bruno Vellutini 10:00 on 2012/03/01 Permalink
    Tags: , , , mex, , , , ,   

    PCRs for new Membranipora and Priapulus primers 

    Cloning newly collected genes of Membranipora and Priapulus. Selected genes and primers:

    Membranipora:

    Mm PIWIL1 R1 CCGTTGTTGACCTGATGCCACTTTCG
    Mm PIWIL1 R2 ACGATGTGATGCTCTCCCTGCTCCATTACC
    Mm DDX4 R1 TCTCTGTGTCTTGTCTGGCATACCCATCG
    Mm DDX4 R2 CAGTCACCTTTCTCGGGTTTGGACACTCTC
    Mm AGO2 F CTTCGCACCTCAGAGGGTAG
    Mm AGO2 R CTGGCCCTGAAAGCTACAAG
    Mm MEX3 F CCAGTGAGAGGAGCTGAACC
    Mm MEX3 R CATCACCACCACACAAGAGG
    Mm MAGOH F TCCGCCATTCTTTCTCTTTG
    Mm MAGOH R TGGTTGAATGCAAGATGGAA

    Priapulus:

    Pc PiwiA F GGGTCTTATTCTTTGTTTGC
    Pc PiwiA R TTCACGACACCATCGCAG
    Pc PiwiB R1 TGCGATACTGCCGACCATCTTCTTGTCC
    Pc PiwiB R2 ACGGGATGTGATGGGCTGTAACCTTTCG
    Pc Tudor R1 TCCACAAAATAGTAGGCAAGGCAAGGGCTC
    Pc Tudor R2 ACGCAACAGATGAACACCTCTACGGCTTGG
    Pc Mael F1 CGTGAAAGAGAGCTGGTCCAGTCAGAATGG
    Pc Mael F2 CACCGCTTCATAGCTCCAGGTGAAATCC
    Pc Mael R1 GCGGTGAAATTCCCTCATAATGCCCTTCTC
    Pc Mael R2 TGGACCAGCTCTCTTTCACGCTTATTTCG
    Pc Pum F1 ATGAACGCAGTGCCTTGGAACGACTCTCAC
    Pc Pum F2 GCAGGACGATGCTATGGTCGGCTATTTC

    01/03/2012

    Regular and first round of RACE with the above primers.

    02/03/2012

    Second round of RACE. Run a gel with only 5 µL of each to identify bands to be cut from RACE and direct purify the products of the regular PCR. Ran another gel with the remaining product to cut the bands*. Extracted promising bands and set the ligation reaction at 22:30.

    • Did not like this procedure. It is better to run the RACE PCR in 10 comb gel with whole 25 µL to get more signal and extract more.

    03/03/2012

    Heat-shock transformation and plating. Also ligation for remaining bands (Mm PIWIL1, Pc Tudor 2,3,4, Pc PUM).

    04/03/2012

    Colony PCR.

    05/03/2012

    Colony PCR for the remaining bands and repetition for some that there was no positive colonies.

    image

    06/03/2012

    Plasmid extraction using 1.5 mL of miniprep culture, sequencing reaction, and dropped at the sequencing facility.

    08/03/12

    Sequences BV25-BV64 returned.

    BV25 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV26 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV27 Membranipora membranacea Mago Nashi T7 ok T7
    BV28 Membranipora membranacea Dicer1 T7 ok + SP6
    BV29 Membranipora membranacea Dicer1 T7 ok + SP6
    BV30 Membranipora membranacea Germ Cell Less R2 T7 ok T7
    BV31 Membranipora membranacea PiwiL1 R2 b2 T7 ok T7
    BV32 Membranipora membranacea PiwiL1 R2 b2 T7 ok + SP6
    BV33 Priapulus caudatus PiwiB R2 b2 T7 ok T7
    BV34 Priapulus caudatus Tudor R2 b1 T7 ok T7
    BV35 Priapulus caudatus Maelstrom F2 T7 ok + SP6
    BV36 Priapulus caudatus Maelstrom F2 T7 ok T7
    BV37 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV38 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV39 Priapulus caudatus Tudor R2 b3 T7 ok T7
    BV40 Priapulus caudatus Tudor R2 b3 T7 ok + SP6
    BV41 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV42 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV43 Priapulus caudatus Pumilio F2 T7 ok + SP6
    BV44 Priapulus caudatus Pumilio F2 T7 ok T7
    BV45 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV46 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV47 Membranipora membranacea Mago Nashi SP6 ok + T7
    BV48 Membranipora membranacea Dicer1 SP6 ok SP6
    BV49 Membranipora membranacea Dicer1 SP6 ok SP6
    BV50 Membranipora membranacea Germ Cell Less R2 SP6 ok + T7
    BV51 Membranipora membranacea PiwiL1 R2 b2 SP6 ok + T7
    BV52 Membranipora membranacea PiwiL1 R2 b2 SP6 ok SP6
    BV53 Priapulus caudatus PiwiB R2 b2 SP6 ok + T7
    BV54 Priapulus caudatus Tudor R2 b1 SP6 ok + T7
    BV55 Priapulus caudatus Maelstrom F2 SP6 ok SP6
    BV56 Priapulus caudatus Maelstrom F2 SP6 ok + T7
    BV57 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV58 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV59 Priapulus caudatus Tudor R2 b3 SP6 ok + T7
    BV60 Priapulus caudatus Tudor R2 b3 SP6 ok SP6
    BV61 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV62 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV63 Priapulus caudatus Pumilio F2 SP6 ok SP6
    BV64 Priapulus caudatus Pumilio F2 SP6 ok + T7

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel