Tagged: germline Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 14:36 on 2013/03/08 Permalink
    Tags: , , , , germline, , , , ,   

    Cloning of Meara RNA binding proteins 

    Initial cloning of Meara RNA binding proteins. Selection: ago a, ago b, ago c, boule, bru a, bru b, gus a, mago, mex3, orb2, stau.

    10/03/13

    Only 3 genes had visible bands: boule, gus a, and stau:

    2013-03-10 17.12.53

    Ligated these overnight.

    11/03/13

    Transformation and plated the genes.

    12/03/13

    Colony PCR with 6 colonies from each:

    2013-03-12 16.58.53

    14/03/13

    Put colonies to grow.

    boule c1 BV226 BV229
    boule c2 BV227 BV230
    boule c3 BV228 BV231
    gus a c1 BV229 BV226
    gus a c2 BV230 BV227
    gus a c3 BV231 BV228
    stau c1 BV232
    stau c2 BV233
    stau c3 BV234

    15/03/13

    Extracted plasmid and did sequencing PCR for all using T7 primer. Dropped tubes into sequencing facility.

    26/03/13

    Checking sequences and they look good, but there is a problem! Minipreps BV226, 227, 228 aligned with gus a and not with boule!!! Check why…

    Screen Shot 2013-03-26 at 10.22.12 AM

     
  • Bruno Vellutini 14:35 on 2012/09/12 Permalink
    Tags: , germline, , ,   

    Pc gmcl and Pc piwia 

    On 05/09/12 I did a PCR for both. Only today I ran the gel and there was no band. Just setup a new reaction with lower annealing temperature (63 °C).

     
  • Bruno Vellutini 16:54 on 2012/08/02 Permalink
    Tags: apical organ, , , germline, , , orthopedia,   

    RACE PCR for Pc gmcl, Mm nk2.1, otp, bruno 

    Setting the first round of RACE PCR for:

    Pc gmcl1 F1/F2, Pc gmcl2 R1/R2, Mm nk2.1 F1/F2, Mm otp R1/R2, Mm celf2 F1/F2.

    Letting overnight.

    03/08/12

    Extraction and ligation.

    04/08/12

    Transformation and plating.

    06/08/12

    Colony PCR

    13/08/12

    Sequencing reaction for Pc gmcl genes.

    BV177 GMCL1 T7
    BV178 GMCL1 T7
    BV179 GMCL1 T7
    BV180 GMCL1 T7
    BV181 GMCL1 T7
    BV182 GMCL2 T7
    BV183 GMCL2 T7

     
  • Bruno Vellutini 12:29 on 2012/07/23 Permalink
    Tags: , , germline, , , , , , , , ,   

    PCR mostly stem/germ cell genes of Terebratalia 

    Setting up a pcr with gradient (63 +- 3 °C) at 12h:

    Gene Primers Tm mean
    Mm Six3/6 64.10
    Tt Dicer1b 61.60
    Tt Runx 63.15
    Tt Mael 65.15
    Tt Piwia 65.55
    Tt Tudor1 61.95
    Tt Ago 62.95
    Tt PL10 63.10
    Tt Pum 65.35

    Extraction and ligation overnight at 4°C, except for MAEL.

    24/07/12

    Transformation and plating of colonies.

    25/07/12

    PL10 and Pumilio had very few colonies on the plate (insert numbers) and together with Piwia they did not produce any positive colony.

    27/07/12

    Put positive colonies to grow for minipreps.

    BV162 Terebratalia transversa Dicer1b
    BV163 Terebratalia transversa Dicer1b
    BV164 Terebratalia transversa Runx2
    BV165 Terebratalia transversa Runx2
    BV166 Terebratalia transversa Runx2
    BV167 Terebratalia transversa Tudor1
    BV168 Terebratalia transversa Argonaute
    BV169 Terebratalia transversa Argonaute
    BV170 Terebratalia transversa Argonaute
    BV171 Terebratalia transversa NK6
    BV172 Terebratalia transversa NK6
    BV173 Terebratalia transversa NK6
    BV174 Terebratalia transversa Wnt7
    BV175 Terebratalia transversa Wnt7
    BV176 Terebratalia transversa Wnt7

     
  • Bruno Vellutini 18:00 on 2012/05/26 Permalink
    Tags: germline, , , , , ,   

    Took pictures of Terebratalia in situ for germline genes vasa, nanos, piwib.

     
  • Bruno Vellutini 12:00 on 2012/04/29 Permalink
    Tags: germline, , , , , ,   

    Abstract submitted to EuroEvoDevo 2012 

    Germ cell development in non-spiralian lophotrochozoans: insights from a bryozoan and a brachiopod

    Bryozoa and Brachiopoda are two spiralian taxa that, unlike other spiralians, undergo non-spiral cleavage and have unique non-trochophore larvae. Previous morphological studies determined that no distinctive germline is formed during embryonic development and that germ cells first appear relatively late in larval life or after metamorphosis. These observations suggest that the specification of primordial germ cells occurs by late inductive signaling (epigenesis) rather than inheritance of maternal determinants (preformation). The molecular mechanisms involved in germ cell formation in bryozoans and brachiopods are currently unknown. We have therefore used RNASeq data to identify and then clone the conserved germline-specific genes vasa, nanos, and piwi from the bryozoan Membranipora membranacea and the brachiopod Terebratalia transversa. In situ hybridization shows that Mm-nanos transcripts are not detected in the blastomeres during early cleavage, but are localized posteriorly in the internal sac region of the late-gastrula stage and early cyphonautes larvae of M. membranacea. In addition, Mm-piwi2 mRNA is present in the cytoplasm of M. membranacea blastomeres and is broadly expressed in the larval tissues, except for the corona and apical organ. Our preliminary results suggest that the signaling related to the differentiation of bryozoan germ cells may be established earlier in ontogeny than previously thought, possibly during gastrulation. A thorough analysis of the expression patterns will provide clues for understanding the regulatory mechanisms of pluripotent and germ cell development in bryozoans and brachiopods and offer further insights about the developmental diversity of spiralians.

     
  • Bruno Vellutini 18:25 on 2011/12/22 Permalink
    Tags: , germline, , , , ,   

    Summary 2011 Bugula/Membranipora germline quest 

    PCR products look ok for all genes except for Bn PIWIL1 R2; there was no band.

    Bugula neritina

    • Repeat RACE PCR for Bn PIWIL1 R2 and Bn PUM1 R2.
    • Repeat ligation and transformation for Bn PUM1 F2.
    • Isolate more germline genes via BLAST.

    Membranipora membranacea

    • Repeat ligation and transformation for Mm PIWIL2, Mm PUM, and Mm TUDOR.
    • Do RACE PCR for the remaining genes (Mm PIWIL1, Mm DDX4, and Mm MAEL).
    • Prepare Mm NANOS for identity check with sequencing.
     
  • Bruno Vellutini 18:00 on 2011/12/01 Permalink
    Tags: , , germline, , ,   

    Bugula neritina germline BLASTing 

    Candidate genes related to germline development were batch BLASTed against the transcriptome of Bugula neritina using the new BLASTer script. Only 2 genes yield transcriptome alignments, Piwi and Pumilio. Here are the reverse BLAST (Bugula sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

    gnl|SRA|SRR034781.65778.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_060538.2		2.45e-29
    	PIWIL2		55124		NP_060538.2		2.45e-29
    
    gnl|SRA|SRR034781.74499.2		(candidates: PIWIL2)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.21e-33
    	PIWIL3		440822		NP_001008496.2		8.22e-29
    	PIWIL4		143689		NP_689644.2		2.39e-28
    	PIWIL2		55124		NP_001129193.1		1.31e-26 <<
    	PIWIL2		55124		NP_060538.2		1.31e-26
    
    gnl|SRA|SRR034781.49286.2		(candidates: PUM2, PUM1)
    	gene		id		accession		e-value
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		3.43e-11 <<
    	PUM1		9698		NP_001018494.1		1.22e-08 <<
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		2.62e-11
    	PUM1		9698		NP_055491.1		1.10e-09
    
    gnl|SRA|SRR034781.80037.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.61e-32 <<
    	PIWIL3		440822		NP_001008496.2		5.27e-28
    	PIWIL4		143689		NP_689644.2		2.00e-27
    	PIWIL2		55124		NP_001129193.1		8.42e-26 <<
    	PIWIL2		55124		NP_060538.2		8.42e-26

    Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

    Obs: low number of hits may be due to the quality of the transcriptome assembly, sequences seem to be short.

    Primers

    PUM1

    5′ and 3′ RACE primers needed

    Bn PUM1 F1    48-77      5'- CCAGACCAGACGGATGTGATTCTCTCAGAG -3'
    	                    30 nt primer on plus strand
    	                    pct G+C:   53.3 	Tm:   72.4
    Bn PUM1 F2    136-164    5'- ACGTGCTGGAACACGGTAGACTGGAGGAG -3'
    	                    29 nt primer on plus strand
    	                    pct G+C:   58.6 	Tm:   74.1
    
    Bn PUM1 R1    456-429    5'- ACTTCCTCAGTGTAGAAACATGGGGGCG -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   72.1
    Bn PUM1 R2    120-93     5'- TGCCATACTGATCCATCACCAGTCGGTC -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   73.3

    PIWIL1

    Only 5′ RACE primers needed.

    Bn PIWIL1 R1             5'- AACTGCCCATCTCCAACTCCATCACGGTAG -3'
    Bn PIWIL1 R2             5'- TTAGGGAAGCCACAAAACCACCGACAG -3'
     
  • Bruno Vellutini 18:00 on 2011/11/25 Permalink
    Tags: , candidate genes, germline, , , , , ,   

    Selection of germline candidate genes 

    Larvae of bryozoans have blastemic cells that remain undifferentiated (or pluripotent? or else? check!) until metamorphosis when they are assigned and build the different adult tissues. Set-aside cells are quite common in organisms with biphasic life cycle and normally are reserved during larval development to differentiate into the larval body (see (10.1002/bies.950190713) for discussion).

    The question now is to check if the germ cell differentiation and stem cell maintenance in these blastemic tissues of bryozoan larvae are bound to common germ line genes and developmental context. Also, how this compare to other larvae (which ones? get some references).

    First step is to look for the presence and localization of expressed genes in bryozoans embryos. For this candidate genes related to germ line development were selected, mostly from Kerner et al. 2011 (10.1093/molbev/msr046) by searching PubMed gene database for human orthologs. Human sequences are better annotated and thus, good candidate genes (Joe S9, 2011). The selected genes are:

    It is a good idea to scan for different stem cell related genes, specially RNA-binding proteins.

    Bibliography

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel