Tagged: engrailed Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 03:50 on 2014/01/13 Permalink
    Tags: engrailed, , ,   

    2nd try for vivo-morpholinos in Terebratalia 

    First experiment with vivo-morpholinos showed that 1-25 µM concentration between 7.0-8.5 °C resulted in no observable phenotype (morphological or behavioral) in the embryos. Thus, I’m setting up a new batch using higher temperatures and higher concentration. Female 18.

    10 °C plate

    FSW CTRL STD CTRL vMO 50 µM Ttra_en_TB_vMO 50 µM Ttra_en_SBe2i2_vMO 50 µM Ttra_wnt1_TB_vMO 50 µM Ttra_wnt1_SBe2i2_vMO 50 µM
    STD CTRL vMO 100 µM Ttra_en_TB_vMO 100 µM Ttra_en_SBe2i2_vMO 100 µM Ttra_wnt1_TB_vMO 100 µM Ttra_wnt1_SBe2i2_vMO 100 µM

    RT plate 18 °C

    FSW CTRL STD CTRL vMO 25 µM Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 2 µM Ttra_wnt1_SBe2i2_vMO 25 µM
    STD CTRL vMO 50 µM Ttra_en_TB_vMO 50 µM Ttra_en_SBe2i2_vMO 50 µM Ttra_wnt1_TB_vMO 50 µM Ttra_wnt1_SBe2i2_vMO 50 µM
    STD CTRL vMO 100 µM Ttra_en_TB_vMO 100 µM Ttra_en_SBe2i2_vMO 100 µM Ttra_wnt1_TB_vMO 100 µM Ttra_wnt1_SBe2i2_vMO 100 µM

    Picked the embryos and incubated the plates.

    13/01/14

    Embryos at RT have reached trilobed stage in the morning and look normal at 25 °C. Embryos at higher concentrations 50 and 100 µM are delayed and still around bilateral/bilobed.

    I fixed RT plate for PCR (RNAlater).

     
  • Bruno Vellutini 21:00 on 2014/01/10 Permalink
    Tags: engrailed, , ,   

    Terebratalia vivo-morpholinos engrailed/wnt1 

    Setting up the first vivo-morpholino assay in Brachiopoda. Here is a description of the oligos prepared by Gene Tools for engrailed and wnt1 genes in Terebratalia.

    Ttra engrailed

    Translation-blocking

    Original sequence: Doutorado:Terebratalia transversa:Loci:Ttra.rna.tri.8524.1
    5′ UTR + (ATG) + 25 coding bp:

    GACAAGTTTTAATTAATATATGGTTGGATATCGGGACATGCTCTGCGTTGTAATCCACTG
    ATCAGCTGTTAGCCGGCCTTTGATACAGATACAGGGACTATGCGAATGTCATTTGGAGGA
    ACTAACCACGTCTGGACAACAGTATTATCAGTGAACCTCGGAAAACAGTGAGACGATTCT
    CAGAGACAATTTCTATAAACTATACTGAACTAGTTAACATTTTATTTAACAATTTTCCAA
    AGGCTGACCCGATATTGATATATCCGGATATACAGGAGAAAACATATCTATAAACAGTCT
    GTACT(ATG)ACACTCATACGAATGGATGTGAATG

    Selected oligo:
    GGATATACAGGAGAAAACATATCTATAA[ACAGTCTGTACT(ATG)ACACTCATAC]GAATGGATGTGA

    @morpholino — BLAST results
    GTATGAGTGTCATAGTACAGACTGT

    @mismatch — BLAST results
    GTtTcAGTcTCATAcTACAcACTGT

    Splice-blocking

    Genomic Ttra en consensus alignment: ~/Biologia/Doutorado/Terebratalia/molecular/morpholinos/Ttra_en_genomic_consensus.aln
    25 bp exon + 25 bp intron (position: 17291-17340) — Ttra_en_mo_e2i2:
    CAAGATATTCTGACCGACCGTCGTCaggtaaggaattataataatacgtt
    Selected oligo:
    CAAGATATTCTGACCG[ACCGTCGTCaggtaaggaattataa]taatacgtt

    @morpholino — BLAST results
    TTATAATTCCTTACCTGACGACGGT

    @mismatch — BLAST results
    TTAaAAaTCgTTACCTcACcACGGT

    Ttra wnt1

    Translation blocking

    Original sequence: Doutorado:Terebratalia transversa:Loci:Ttra.rna.tri.7468.1
    5′ UTR + (ATG) + 25 coding bp:

    GGCAGATCCTCAGATCGTATCTTGTCCCTGTTTATAGTCAGTCATGTTCATGTAGAACAC
    GTATGTTGTGATTCCCTTTTCTTGTGTTGCACGGATGTACGACAGCTGTATTTGAAAAGC
    GACAGCCCGATTGATGAACACTGGGGAACAATGCCGACGCGACATCAAAAGAACTTTTTA
    TCAACACGAGGTATTTTAACGTTAATACAGTAGCAGCCTGCCTGAACGAGACCTTCGAAG
    CACGAGACATTACTCTAAAATCCAAAACGGGGCGGTCTGATCCTCGATTGCTGTACAATT
    TATGGTATGTCACACAATAAACTCGCACAATACACGAGTGTGATTGGCATACAAGAGCGG
    CACACATCAAAAGAAGAGAAAGTTCCGCATCAAGCCTTAACATTTTACACGGATACATCG
    GACAGTGAACATGTTCTTTTTATTTCGTAAGAGAAAACAGAAGCTGTCCACGTGCAGGAG
    TATCAAACGTCACTAATTAATTAAAGTGCGATCTTAATTAATGTGATAAAATTTATTTTA
    ACGAAACCACGTGTGGAGTAGACGATCAACCTTTTTAATTGGATTATCAGTTTTGAGCAC
    CCTCTTTATTAAAAGTTTACAAAAAGATTTAAAACAGGGACTCAACACTCAGAAGTAAAC
    AACATATATATACACTTACGCACACTATTGTGTTTTAAGAATACTTTATTTTTGAAATCG
    TTAATCTTTGTCTGTGTATTGGGTCGCGTTACGACATTATTTACTAGTGTTGTTGTGT(A
    TG)AGACAAGAATACGACATGAACATCA

    Selected oligo:
    TAATCTTTGTCTGTGTATTGGGTCGCGTTACGACATTATTTACTAGTGTTGTT[GTGT(ATG)AGACAAGAATACGACATG]AACA

    @morpholino — BLAST results
    CATGTCGTATTCTTGTCTCATACAC

    @mismatch — BLAST results
    CATcTCcTATTgTTcTCTgATACAC

    Splice-blocking

    Genomic Ttra wnt1 consensus alignment: ~/Biologia/Doutorado/Terebratalia/molecular/morpholinos/Ttra_wnt1_genomic_consensus.aln
    25 bp exon + 25 bp intron (position: 5186-5235) — Ttra_wnt1_mo_e2i2:
    CATTTATACAGAGGCGTACGGTGGTggtaagtaagacaataccttgtatc
    Selected oligo:
    CATTTATACAGAGGCGTAC[GGTGGTggtaagtaagacaatacct]tgtatc

    @morpholino — BLAST results
    AGGTATTGTCTTACTTACCACCACC

    @mismatch — BLAST results
    AGcTATTcTCTTAgTTACgAgCACC

    Experiment

    24-well plate (500 µL) with humid chamber and keep on incubator. vMO stock concentration: 0.5 mM. Add vMO at swimming blastula stage to prevent any initial translation. I prepared 250 µL of vivo-morpholino dilutions and added 250 µL of embryos.

    FSW CTRL STD CTRL vMO 1 µM Ttra_en_TB_vMO 1 µM Ttra_en_SBe2i2_vMO 1 µM Ttra_wnt1_TB_vMO 1 µM Ttra_wnt1_SBe2i2_vMO 1 µM
    STD CTRL vMO 5 µM Ttra_en_TB_vMO 5 µM Ttra_en_SBe2i2_vMO 5 µM Ttra_wnt1_TB_vMO 5 µM Ttra_wnt1_SBe2i2_vMO 5 µM
    STD CTRL vMO 10 µM Ttra_en_TB_vMO 10 µM Ttra_en_SBe2i2_vMO 10 µM Ttra_wnt1_TB_vMO 10 µM Ttra_wnt1_SBe2i2_vMO 10 µM
    STD CTRL vMO 25 µM Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 25 µM Ttra_wnt1_SBe2i2_vMO 25 µM

    Incubated 20h late blastula at 7.5 °C in turned off outdoor incubator. ~2 am temperature was 8.5 °C.

    11/01/2014

    Checked samples during the morning. All wells had actively swimming radial gastrula and some dead embryos. FSW control and 1 µM samples had more active embryos. Letting it go longer.

    18:00 All wells with swimming asymmetric gastrula. Ectoderm of larvae at 25 µM seems not perfectly integer. I observed some round flattened gastrula which did not become bilateral on the wnt1 splice-blocking 25 µM well, but might be just a coincidence.

    12/01/2014

    Embryos still look ok and have reached the bilateral stage. Temperature dropped to 7.0 °C.

    I will fix them in RNAlater tonight or tomorrow morning.

     
  • Bruno Vellutini 10:36 on 2013/12/16 Permalink
    Tags: , engrailed, ,   

    Propidium+Phallacidin and Murray Clear for Novocrania engrailed fluorescent in situ 

    Since mounting with TDE was not so good (crystals and some weird noisy background) I am staining with propidium iodide and phallacidin and mounting with murray clear. This should give a clean embryo with the mesodermal signal visible enough for details. Fluorochrome for engrailed is Cy5.

    17/12/13

    Confocal.

     
  • Bruno Vellutini 17:45 on 2013/11/23 Permalink
    Tags: engrailed, ,   

    Novocrania engrailed fluorescent in situ 

    Began a fluorescent in situ of Novocrania engrailed to better understand the mesodermic expression. The only difference this time was 10 min of half-concentrated proteinase-k (1.25 µL in 5 mL) instead of 5 min.

    24/11/13

    Diluted new probe and added to the sample.

    26/11/13

    Wash day went on smoothly. Added 1:100 anti-dig-pod antibody and incubated in the cold room.

    27/11/13

    Wash off antibody.

    • Developed with TSA Cy5 for 2h.
    • Stopped reaction with 2x 5 min in detergent solution at 62 °C.
    • 1x 5 min in detergent solution at RT.
    • 3x 5 min PTw at RT.
    • Selected 6 embryos of different stages and went through TDE steps until final 97% + DAPI.
    • Letting overnight in cold room.

    28/11/13

    Crystals have formed and are sticking around the embryos… Mounted a slide and it works, although there is background.

    29/11/13

    Confocal at 8h!

    Nano en TDE 1.lif - Series004 s1 Nano en TDE 1.lif - Series004 s2 Nano en TDE 1.lif - Series004 s3

     
  • Bruno Vellutini 17:03 on 2013/10/27 Permalink
    Tags: engrailed, , ,   

    Novocrania in situ 3rd try 

    Third try with engrailed, wnt1, and wnt5. This time using half-concentrated 5 min ProteinaseK treatment. They should not get damaged!

    • Fixed for 1h25min.
    • Washed normally and incubated in pre-hybe.

    28/10/13

    Added probes at 11h.

    30/10/13

    Washing day embryos looking good.

    31/10/13

    Washed out antibody with long 30 min washes.

    01/11/13

    Started developing. Engrailed began to appear after 2hs, but nothing in the wnts. I exchanged the AP substrate every 2 hours. At 18h I transferred to new wells because crystals were forming. At 19h30 I exchanged the AP and put them in the cold room.

    02/11/13

    Stopped engrailed and continued developing the wnts during the day. No signal came up except for background. Paused in AP without magnesium.

    04/11/13

    Restarted the wnts to see if something comes up…

    05/11/13

    Stopped wnts… Ethanol washes and added glycerol+DAPI overnight in cold room.

    06/11/13

    Mount slides. Engrailed has some shitty background… Remember next time to stop before overnight.

     
  • Bruno Vellutini 13:20 on 2013/10/21 Permalink
    Tags: , engrailed, , , , ,   

    Terebratalia additional double in situs 

    Started Terebratalia double in situs with the following selected probes. Everything looks ok.

    wnt1 (DNP) + wnt4 (DIG) en (DNP) + wnt7 (DIG)
    wnt1 (DNP) + wnt8 (DIG) en (DNP) + pax258 (DIG)

    22/10/13

    • Added probes to Terebratalia doubles.

    24/10/13

    • Terebratalia doubles washing day.
    • Add Terebratalia first antibody anti-dig-pod 1:250.

    25/10/13

    • Terebratalia doubles wash off first antibody.

    27/10/13

    • Terebratalia doubles develop first probe and inactivate.
    • Terebratalia doubles incubate with second antibody.

    28/10/13

    • Terebratalia doubles wash off second antibody.

    29/10/13

    • Terebratalia doubles develop second probe.
    • Terebratalia doubles stain with phallacidin.
    • Terebratalia doubles embed in TDE+DAPI.

    30/10/13

    • Mount Terebratalia doubles.

    31/10/13

    • Confocal slot for Terebratalia doubles.

    01/11/13

    Here are some scans.

     
  • Bruno Vellutini 09:55 on 2013/10/15 Permalink
    Tags: engrailed, , ,   

    Novocrania in situ en wnt1 wnt5 2nd try 

    Second chance on the Novocrania in situ which failed last time. This time I’ll do 7 minutes of ProtK and wash extensively with glycine to stop the reaction.

    3 embryos of each stage: radial, bilateral, early larva, and larva.

    engrailed wnt1 wnt5
    • Initially in MeOH.
    • 1x 5min 60% MeOH 40% PTw.
    • 1x 5 min 30% MeOH 70% PTw.
    • 4x 5 min PTw.
    • ProteinaseK for 7 min.
    • Stopped exactly at 7 min with 900 µL of glycine.
    • 1x 5 min glycine.
    • 1x 5 min 1% TEA.
    • 1x 5 min 1% TEA + Ac. An. –> embryos stick a bit to bottom.
    • Added 100 µL of Ac An. embryos continue to stick.
    • Washed 2x PTw 900 µL.
    • Fixed in 4% FA for 1h25.
    • Washed 3x PTw.
    • 1x 10 min PTw at 80 °C.
    • 1x 5 min PTw.
    • 1x 10 min Hybe Buffer at RT.
    • Exchanged hybe and incubate at 62 °C.

    16/10/13

    • Added probes.
    • Embryos were still looking ok, although somewhat transparent.

    18/10/13

    • Larvae look damaged and may fall apart. Saw a bilateral missing a piece… Otherwise it looks better than last time. I think the time or concentration of ProtK (newly opened) really needs to be decreased!
    • 10 min and 40 min washes with hybe wash.
    • Series of 30 min hybe to 2x SSC.
    • 3x 20 min 0.2X SSC + 0.1% Tween-20.
    • Grade-series of 0.2X SSC to PTw 10 min each.
    • 5x 5 min PBT.
    • Incubate 1h with 1x blocking buffer made with the last 500 µL of 5x blocking buffer from the fridge and newly made maleic acid buffer.
    • Exchanged for 1:5000 Anti-DIG-AP in blocking buffer and incubated overnight in cold room.

    19/10/13

    Embryos still look integer although larvae are damaged.

    • Started washing with PBT at 13h.

    20/10/13

    • Began to develop at 16h.
    • Faint band of engrailed at 19h.
    • Noticed some precipitated when exchanging NBT/BCIP, maybe old BCIP (it is running out)?
    • Let overnight in the cold room.

    21/10/13

    • Checked at 11h and the engrailed stripe was more prominent; nothing yet in the others.
    • There are crystals forming in the bottom :( and some clear precipitate floating around…
    • I exchanged the AP substrate and let it go under RT.
    • Exchanged again after 2h.
    • Final exchange and cold room at 17h30. Maybe there was a bit of background coming up in engrailed… not sure so I let it overnight and will stop tomorrow.

    22/10/13

    • engrailed well began to show some background and the others were looking bad with crystals packing up. So I stopped them all.
    • AP -magnesium 2x.
    • Ethanol washes.
    • 70% Glycerol exchanged once for glycerol with 1:5000 DAPI.
    • I restarted the wnts because I felt bad. Let them develop overnight.

    23/10/13

    • Stopped wnts and did alcohol series.
    • Mounted and took photos of engrailed.
     
  • Bruno Vellutini 18:36 on 2013/09/24 Permalink
    Tags: engrailed, , , ,   

    Novocrania in situ en, wnt1, wnt5 

    Started an in situ with Novocrania! I picked 3 specimens of each stage making 12 embryos in total. The stages are: radial, bilateral gastrula, early larva and larva.

    Nano en Nano wnt1 Nano wnt5

    All 12 embryos per well survived the first day.

    25/09/13

    Since engrailed probe had low concentration I diluted what I had (13 ng/µL) into 200 µL of hybe (resulting in 0.5 ng/µL) and added anyway. I’m synthesizing more so that I can add tomorrow.

    26/09/13

    Changed engrailed hybe with nice new probe. However, embryos are really transparent. Larval morphology also does not look normal. I think something is wrong.

    27/09/13

    Engrailed well has not any normal looking embryos anymore. They are all falling apart. In the other 2 wells there are still 4-5 embryos that look ok, but fragile.

    I continued with the washes anyway and incubated with the antibody overnight at 4 °C.

     
  • Bruno Vellutini 14:52 on 2013/09/22 Permalink
    Tags: engrailed, , ,   

    Probe synthesis of Novocrania segmentation 

    After successfully cloning Novocrania genes using Andi’s primers it is time for probe synthesis.

    Set Probe PCR for en, wnt1 and wnt5.

    23/09/13

    Gel and extraction went fine, except that I forgot the dna ladder…

    2013-09-23 23.37.45

    Extracted the probe PCR.

    24/03/13

    Began probe synthesis transcription reaction at 10h and stopped at 16h. Everything normal.

    25/03/13

    After centrifuging there was a very small pellet for engrailed. Wnt1 and wnt5 had normal pellets. Here are the nanodrop:

    Plasmid Gene Enzyme ng/µL
    BV267 engrailed SP6 13.08
    BV271 wnt1 SP6 156.92
    BV274 wnt5 SP6 54.99

    Since engrailed was so low I started a new transcription reaction at 12h.

    26/09/13

    Good engrailed concentration! 1334 ng/µL.

     
  • Bruno Vellutini 01:01 on 2013/09/10 Permalink
    Tags: engrailed, , ,   

    Novocrania one more time 

    Using Andi’s primers with annealing temperature at 57 °C.

    11/09/13

    Engrailed rendered a band at the expected size (638 bp), although it is a bit spread band. It is quite possible that wnt1 had a band at the right place (718 bp), but it was very weak; I cut it anyway. Wnt5 band was also at the correct place (932 bp), but also weak.

    2013-09-11 16.37.23

    Set ligation reaction at 16h and stored at 4°C.

    12/09/13

    Transformation and plating.

    13/09/13

    en had a lot of colonies, wnt1 had a normal amount, and wnt5 had a few colonies. I managed to do 10 colonies for the first two and 8 colonies for wnt5:

    2013-09-16 10.57.37

    16/09/13

    Picked colonies for minipreps

    gene colony T7
    en 8 BV266
    en 9 BV267
    en 10 BV268
    wnt1 1 BV269
    wnt1 2 BV270
    wnt1 3 BV271
    wnt5 1 BV272
    wnt5 2 BV273
    wnt5 3 BV274

    17/09/13

    • Extracted plamids.

    18/09/13

    • Set sequencing pcr at 10:30.
    • Dropped sequences at the facility at 14:30.

    22/09/13

    Checked the alignment and it looks good! See files: Nano_en-wnt1-wnt5

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel