Tagged: Bugula neritina Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 21:59 on 2012/01/11 Permalink
    Tags: Bugula neritina, , , , ,   

    Debugging PCRs with Bn PUM1 F2, Mm MAEL F2, Mm PUM, Mm TDRD1 

    11/01/12

    RACE PCR: Bn PUM1 F2, Mm MAEL F2

    PCR: Mm PUM, Mm TDRD1

    BnMmPCRs 2012-01-11 19hr 04min

    I cut the bands from the RACE PCR very quickly under UV light (<10s each) and purified regular PCR directly (band was not cut from the gel). This is to be sure that exposure to UV is not damaging the samples, which could be responsible for the ligation failures.

    Standard ligation set up at 21:00 (protocol values).

    12/01/12

    Heat shock transformation and plating at 17:30, looking good.

    13/01/12

    Bn PUM1 F2 and Mm MAEL F2 did not have many colonies (6 and 3, respectively). The latter could be because of the amount of PCR product interfering in the ligation. Mm PUM and Mm TDRD1 had extra colonies and I included 6 of each in the colony check PCR, started at 10:50.

    MmColony 2012-01-13 15hr 17min

    Positive colonies! Looks like purifying PCR product directly is more worth it, if there is only one band. Apparently the UV was indeed damaging the DNA from the samples. Asterisks marks are colonies to be picked for the MiniPreps.

    Bn PUM1 F2 No positive colonies, only a 500 bp one.
    Mm MAEL F2 Positive: 1, 2, 3
    Mm PUM Positive: 3, 4, 6
    Mm TUDOR Positive: 3, 4, 5 (2 also, but bit shorter)

    15/01/12

    Add 3 mL of LB to MiniPrep tubes and leave in the shaker.

     
  • Bruno Vellutini 18:00 on 2012/01/11 Permalink
    Tags: Bugula neritina, , , ,   

    Extra heat shock transformation 

    11/01/12

    I did an additional heat shock transformation using new Aina’s newest cells and the most recent ligation. Used the following samples Bn PUM1 F2, Mm MAEL F2, Mm PUM, Mm TDRD1, Control 1 (1.5 µl of ligation mix, what was left) and plated at 17:00.

    12/01/12

    Not enough colonies.

     
  • Bruno Vellutini 11:37 on 2012/01/09 Permalink
    Tags: Bugula neritina, , , , , , , ,   

    New ligation/transformation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1 

    08/01/12

    Set a new ligation for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, Mm PIWIL1 R1, Mm PUM, Mm TDRD1; + 2 control tubes using the same amount (1.5 µl) of the control DNA insert.

    09/01/12

    Transformation using 3 µl of ligation per tube, except for Control 2 where I added 5 µl of ligation. Plated with 400 µl and waited plates to be completely dry to incubate at 37 °C at 19:00.

    NanoDrop

    Chema suggested to quantify the amount of DNA in the PCR products to be able to calculate the quantity to be used in the ligation reaction. To do this I used NanoDrop spectophotometer.

    Bn PUM1 F2 Mm MAEL F2 Mm DDX4 R2 Mm PIWIL1 R1 Mm PUM Mm TDRD1
    260/280 2.54 2.02 1.87 0.63 2.12 2.21
    260/230 0.77 1.47 0.29 -0.02 0.79 0.41
    ng/µl 56.3 207.7 24.0 -6.2 62.6 64.3

    260/280: ratio of sample absorbance at 260 and 280 nm. The ratio of absorbance at 260 and 280 nm is used to assess the purity of DNA and RNA. A ratio of ~1.8 is generally accepted as “pure” for DNA; a ratio of ~2.0 is generally accepted as “pure” for RNA. If the ratio is appreciably lower in either case, it may indicate the presence of protein, phenol or other contaminants that absorb strongly at or near 280 nm.

    260/230: ratio of sample absorbance at 260 and 230 nm. This is a secondary measure of nucleic acid purity. The 260/230 values for “pure” nucleic acid are often higher than the respective 260/280 values. They are commonly in the range of 1.8-2.2. If the ratio is appreciably lower, this may indicate the presence of co-purified contaminants.

    ng/uL: sample concentration in ng/uL based on absorbance at 260 nm and the selected analysis constant.

    From NanoDrop User Guide.

    According to Aina, the contamination at the 260/230 is from the extraction buffer and should not interfere with the ligation.

    10/01/12

    Colony growth was better this time, but I still should be getting more colonies than now for some samples. Increase in colony number might be due to the plating amount (400 µl) or even the 1 µL increase in the PCR product for the ligation.

    Gene Colonies Picked
    Bn PUM1 F2 ~10 6
    Mm MAEL F2 3 3
    Mm DDX4 R2 Many 6
    Mm Piwil1 R1 5 5
    Mm PUM ~15 6
    Mm TDRD1 ~10 6
    Control 1 7 5
    Control 2 Many 5

    Colony checking PCR started at 14:00.

    11/01/12

    No positive colonies… Repeat.

    Ms_Colony2_110112MmColony 2012-01-11 12hr 23min

     
  • Bruno Vellutini 15:02 on 2012/01/07 Permalink
    Tags: Bugula neritina, , , , , , ,   

    Colony testing for Mm PIWIL2, NANOS, PUM, TDRD1, and Bn PUM1, DDX4 

    Colony picking and testing for the following genes from the RACE PCR and regular PCR with Membranipora genes. PCR started at 14:20 and samples consist of:

    Gene Colonies
    Bn PUM1 F2 1
    Mm DDX4 R2 1
    Mm PIWIL2 8
    Mm NANOS 8
    Mm PUM 5
    Mm TUDOR 3

    Mm PIWIL2 and Mm NANOS had positive colonies. Mm PUM, Mm TDRD1, and Bn PUM1 F2 were negative. Mm DDX4 R2 is probably not positive (less than 500bp).

    Colony check 2012-01-07 18hr 21min

     
  • Bruno Vellutini 18:38 on 2012/01/04 Permalink
    Tags: Bugula neritina, , , , , ,   

    RACE PCR for Membranipora and Bugula 

    03/01/12

    Repeating RACE PCR for Bugula genes tried previously since only Bn PUM1 F2 was amplified properly according to the PCR product check. Genes from Membranipora will also be done. Genes and primers (7 reactions):

    Bugula Membranipora
    Bn PUM1 F1 Mm PIWIL1 R1
    Bn PUM1 F2 Mm PIWIL1 R2
    Bn PUM1 R1 Mm DDX4 R1
    Bn PUM1 R2 Mm DDX4 R2
    Bn PIWIL1 R1 Mm MAEL F1
    Bn PIWIL1 R2 Mm MAEL F2
    Mm MAEL R1
    Mm MAEL R2

    1st round started at 13:00; 2nd round started at 17:40.

    04/01/12

    Agarose gel for Bugula neritina:

    Bugula RACE Pumilio and Piwi

    Only Bn PUM1 F2 had a strong band, the gel was quite similar to the previous RACE PCR run. The faint band marked with “…” Mn PUM1 R2 was cut and frozen if needed in the future.

    Gel for Membranipora membranacea:

    Membranipora RACE Maelstron, Vasa, Piwi

    Mn MAEL F2 had a strong band, as well as Mm DDX4 R2 and Mm PIWIL1 R1. I cut and frozen the short and faint bands Mm MAEL R2 and Mm PIWIL1 R2.

    Extraction and ligation done for Bn PUM1 F2, Mm MAEL F2, Mm DDX4 R2, and Mm PIWIL1 R1 at 17:00 and left at 4 °C overnight. Extra pipetting for mixing ligation components.

    05/01/12

    Heat shock transformation and incubated the 4 plates at 37 °C.

    06/01/12

    No colonies grew on the plates :( Actually one colony for Bn PUM1 F2. Kevin suggested to do the plating quickly and to not dry out the cells.

    I repeated the transformation using the ligation from yesterday, while transforming the regular PCR from Membranipora. Plating at 18:30.

    07/01/12

    Again the number of colonies was low, only one colony for Bn PUM1 F2 and Mm DDX4 R2. Ligation and transformation needs to be repeated. Started a colony testing for both.

    08/01/12

    Repeat the ligation for these 4 samples using the ligation control.

     
  • Bruno Vellutini 18:25 on 2011/12/22 Permalink
    Tags: Bugula neritina, , , , , ,   

    Summary 2011 Bugula/Membranipora germline quest 

    PCR products look ok for all genes except for Bn PIWIL1 R2; there was no band.

    Bugula neritina

    • Repeat RACE PCR for Bn PIWIL1 R2 and Bn PUM1 R2.
    • Repeat ligation and transformation for Bn PUM1 F2.
    • Isolate more germline genes via BLAST.

    Membranipora membranacea

    • Repeat ligation and transformation for Mm PIWIL2, Mm PUM, and Mm TUDOR.
    • Do RACE PCR for the remaining genes (Mm PIWIL1, Mm DDX4, and Mm MAEL).
    • Prepare Mm NANOS for identity check with sequencing.
     
  • Bruno Vellutini 19:35 on 2011/12/12 Permalink
    Tags: Bugula neritina, , ,   

    Bugula neritina RACE PCR for Pumilio and Piwi 

    12/12/11

    Setting up the first round for RACE PCR of 2 Bugula neritina genes, PUM1 (pumilio) and PIWIL1 (piwi), identified before. Using existing 5′ and 3′ cDNA templates from the lab from the Bn gene expression paper (10.1186/2041-9139-2-13).

    PUM1 — incomplete, needs both 5′ and 3′ ends.

    PIWIL1 — only needs 5′ end.

    PRIMERS — Bn PUM1 F1, Bn PUM1 R1, Bn PIWIL1 R1

    Started 3 reactions at 17:00 using BDRACE program and samples will be left overnight in the cycler.

    13/12/11

    Started second round for 3 reactions (+2 controls each) using the first round as templates at 17:00 using BDRACE program and samples will be left overnight in the cycler.

    PRIMERS — Bn PUM1 F2, Bn PUM1 R2, Bn PIWIL1 R2 (+ GS and NUP controls).

    14/12/11

    Running the gel with the amplified products. Two bands were present (a 5′ RACE and a 3′ RACE).

    PUM1 F2: strong band around 1500 bp
    PUM1 R2: no band
    PIWIL1 R2: faint band around 1500 bp

    Cut bands and started a ligation reaction at 17:00 and incubated at 4 °C.

    Bn_RACE_141211

    15/12/11

    Executed heat shock transformation for bacteria to incorporate plasmids and setup cultures. Incubated the plates at 37 °C overnight.

    16/12/11

    Both plates (Pumilio F2 and Piwi R2) had cultures. Plates were transferred to the fridge until Monday.

    19/12/11

    PCR colony testing

    • Chose 8 colonies from each plate and circled them.
    • Set up 16 eppendorfs (2mL) with quantities as in the protocol.
    • Picked each colony with a stick (inside tip) and put them inside each tube.
    • Draw grid and identifications on a new plate taken from the cold room and pass the point of the toothpick in each field.
    • Sealed 2 source plates with parafilm and incubated new plate at 37 °C.
    • PCR ~16:00 (35 cycles, temp?) and kept at 4 °C in the cycler.

    20/12/11

    Ran the gel with 8 Piwi colonies and 8 Pumilio colonies at 11:00 (100V, 45min). No colony product showed the expected length of ~1500bp.

    Bugula neritina colony testing gel

    NEEDS TO BE REPEATED

    Bibliography

     
  • Bruno Vellutini 18:00 on 2011/12/01 Permalink
    Tags: , Bugula neritina, , , ,   

    Bugula neritina germline BLASTing 

    Candidate genes related to germline development were batch BLASTed against the transcriptome of Bugula neritina using the new BLASTer script. Only 2 genes yield transcriptome alignments, Piwi and Pumilio. Here are the reverse BLAST (Bugula sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

    gnl|SRA|SRR034781.65778.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_004755.2		2.77e-31 <<
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL1		9271		NP_001177900.1		2.77e-31
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
    	PIWIL2		55124		NP_060538.2		2.45e-29
    	PIWIL2		55124		NP_060538.2		2.45e-29
    
    gnl|SRA|SRR034781.74499.2		(candidates: PIWIL2)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.21e-33
    	PIWIL3		440822		NP_001008496.2		8.22e-29
    	PIWIL4		143689		NP_689644.2		2.39e-28
    	PIWIL2		55124		NP_001129193.1		1.31e-26 <<
    	PIWIL2		55124		NP_060538.2		1.31e-26
    
    gnl|SRA|SRR034781.49286.2		(candidates: PUM2, PUM1)
    	gene		id		accession		e-value
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		1.67e-54 <<
    	PUM1		9698		NP_001018494.1		3.43e-11 <<
    	PUM1		9698		NP_001018494.1		1.22e-08 <<
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		1.67e-54
    	PUM1		9698		NP_055491.1		2.62e-11
    	PUM1		9698		NP_055491.1		1.10e-09
    
    gnl|SRA|SRR034781.80037.2		(candidates: PIWIL2, PIWIL1)
    	gene		id		accession		e-value
    	PIWIL1		9271		NP_004755.2		4.61e-32 <<
    	PIWIL3		440822		NP_001008496.2		5.27e-28
    	PIWIL4		143689		NP_689644.2		2.00e-27
    	PIWIL2		55124		NP_001129193.1		8.42e-26 <<
    	PIWIL2		55124		NP_060538.2		8.42e-26

    Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

    Obs: low number of hits may be due to the quality of the transcriptome assembly, sequences seem to be short.

    Primers

    PUM1

    5′ and 3′ RACE primers needed

    Bn PUM1 F1    48-77      5'- CCAGACCAGACGGATGTGATTCTCTCAGAG -3'
    	                    30 nt primer on plus strand
    	                    pct G+C:   53.3 	Tm:   72.4
    Bn PUM1 F2    136-164    5'- ACGTGCTGGAACACGGTAGACTGGAGGAG -3'
    	                    29 nt primer on plus strand
    	                    pct G+C:   58.6 	Tm:   74.1
    
    Bn PUM1 R1    456-429    5'- ACTTCCTCAGTGTAGAAACATGGGGGCG -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   72.1
    Bn PUM1 R2    120-93     5'- TGCCATACTGATCCATCACCAGTCGGTC -3'
    	                    28 nt primer on minus strand
    	                    pct G+C:   53.6 	Tm:   73.3

    PIWIL1

    Only 5′ RACE primers needed.

    Bn PIWIL1 R1             5'- AACTGCCCATCTCCAACTCCATCACGGTAG -3'
    Bn PIWIL1 R2             5'- TTAGGGAAGCCACAAAACCACCGACAG -3'
     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel