Tagged: argonaute Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 10:11 on 2014/05/08 Permalink
    Tags: argonaute, , , , ,   

    Probe synthesis Ttra frizzleds Nano dlx and more 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77
    Gene Miniprep Antisense Enzyme ng/µL
    Nano dlx BV285 SP6  159
    Ttra fz5-8 BV288 SP6  366
    Ttra fz7 BV291 SP6  2439
    Ttra dicer1b BV162 SP6  1867
    Ttra tudor1 BV167 SP6  1076
    Ttra argonaute BV168 SP6  323

    Started probe PCR.

    2014-06-05 17.42.43

    09/05/14

    Began probe synthesis at 10:30.

    10/05/14

    Done with probe synthesis, see values above.

     
  • Bruno Vellutini 16:28 on 2013/08/02 Permalink
    Tags: argonaute, , , , , , , ,   

    Meara in situ for RNA binding proteins 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Starting in situ with mixed stages of Meara. 15 min protk.

    ago a ago b boule bruno a
    gus a mago orb2 staufen

    03/08/13

    Added probes.

    05/08/13

    First day of washes. Some small juveniles have ripped tissues. I guess the 15min protk is too much for them, the rest looks ok.

    06/08/13

    Regular 5 PBT and 5 PTw antibody washes. Kept rocking in cold room.

    07/08/13

    Developing day. Stopped argonaute after ~3h, they were becoming too dark. Bruno, Staufen are clearly there. Boule is weaker, but something. The rest there is nothing. Putting new AP in cold room.

    08/08/13

    In addition to Argonaute I also stopped Bruno, Staufen and Orb2 before going to the collection trip. The rest are developing overnight a bit more (also included Orb2 to develop overnight.

     
  • Bruno Vellutini 11:26 on 2013/05/21 Permalink
    Tags: argonaute, , , , , , , ,   

    Probe synthesis for Meara RNA binding proteins 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Began the probe PCR for RNA binding proteins in Meara. Finished by May 24th.

    Gene ID ENZYME ng/µL
    Ms gus a BV226 T7 3409
    Ms boule BV229 SP6 501
    Ms staufen BV233 SP6 1141
    Ms ago a BV237 SP6 563
    Ms ago b BV238 SP6 1236
    Ms bru a BV242 SP6 1226
    Ms mago nashi BV244 SP6 336
    Ms orb2 BV247 T7 473

    Ms RNA binding

     
  • Bruno Vellutini 17:10 on 2013/03/25 Permalink
    Tags: argonaute, , , , , , ,   

    Cloning of Terebratalia wnt2 and other Meara RNA binding proteins 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Started a PCR with Terebratalia wnta, wnt2; and Meara ago a, ago b, ago c, bru a, bru b, mago, mex3, orb2.

    2013-03-26 11.47.59 2013-03-28 15.23.26

    12/04/13

    Put colonies to grow.

    Colony T7
    Ago a c1 BV235
    Ago a c2 BV236
    Ago a c3 BV237
    Ago b c1 BV238
    Ago b c2 BV239
    Ago b c4 BV240
    Bru a c1 BV241
    Bru a c2 BV242
    Bru a c3 BV243
    Mago c1 BV244
    Mago c2 BV245
    Mago c3 BV246
    Orb2 c1 BV247

     
  • Bruno Vellutini 14:36 on 2013/03/08 Permalink
    Tags: argonaute, , , , , , , , ,   

    Cloning of Meara RNA binding proteins 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Initial cloning of Meara RNA binding proteins. Selection: ago a, ago b, ago c, boule, bru a, bru b, gus a, mago, mex3, orb2, stau.

    10/03/13

    Only 3 genes had visible bands: boule, gus a, and stau:

    2013-03-10 17.12.53

    Ligated these overnight.

    11/03/13

    Transformation and plated the genes.

    12/03/13

    Colony PCR with 6 colonies from each:

    2013-03-12 16.58.53

    14/03/13

    Put colonies to grow.

    boule c1 BV226 BV229
    boule c2 BV227 BV230
    boule c3 BV228 BV231
    gus a c1 BV229 BV226
    gus a c2 BV230 BV227
    gus a c3 BV231 BV228
    stau c1 BV232
    stau c2 BV233
    stau c3 BV234

    15/03/13

    Extracted plasmid and did sequencing PCR for all using T7 primer. Dropped tubes into sequencing facility.

    26/03/13

    Checking sequences and they look good, but there is a problem! Minipreps BV226, 227, 228 aligned with gus a and not with boule!!! Check why…

    Screen Shot 2013-03-26 at 10.22.12 AM

     
  • Bruno Vellutini 12:29 on 2012/07/23 Permalink
    Tags: argonaute, , , , , , , , , , ,   

    PCR mostly stem/germ cell genes of Terebratalia 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Setting up a pcr with gradient (63 +- 3 °C) at 12h:

    Gene Primers Tm mean
    Mm Six3/6 64.10
    Tt Dicer1b 61.60
    Tt Runx 63.15
    Tt Mael 65.15
    Tt Piwia 65.55
    Tt Tudor1 61.95
    Tt Ago 62.95
    Tt PL10 63.10
    Tt Pum 65.35

    Extraction and ligation overnight at 4°C, except for MAEL.

    24/07/12

    Transformation and plating of colonies.

    25/07/12

    PL10 and Pumilio had very few colonies on the plate (insert numbers) and together with Piwia they did not produce any positive colony.

    27/07/12

    Put positive colonies to grow for minipreps.

    BV162 Terebratalia transversa Dicer1b
    BV163 Terebratalia transversa Dicer1b
    BV164 Terebratalia transversa Runx2
    BV165 Terebratalia transversa Runx2
    BV166 Terebratalia transversa Runx2
    BV167 Terebratalia transversa Tudor1
    BV168 Terebratalia transversa Argonaute
    BV169 Terebratalia transversa Argonaute
    BV170 Terebratalia transversa Argonaute
    BV171 Terebratalia transversa NK6
    BV172 Terebratalia transversa NK6
    BV173 Terebratalia transversa NK6
    BV174 Terebratalia transversa Wnt7
    BV175 Terebratalia transversa Wnt7
    BV176 Terebratalia transversa Wnt7

     
  • Bruno Vellutini 15:19 on 2012/05/24 Permalink
    Tags: argonaute, , , , , , , ,   


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Primers for more Terebratalia germline genes have arrived.

    • Tt dicer1b
    • Tt runx2
    • Tt maelstrom
    • Tt tudor1
    • Tt pl10
    • Tt ago
    • Tt pum
     
  • Bruno Vellutini 17:48 on 2012/05/15 Permalink
    Tags: argonaute, , , , , , , , , ,   

    Probe synthesis for Terebratalia segmentation 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Beginning probe synthesis for:

    Tt netrin BV110 SP6
    Tt patched BV115 SP6
    Tt hedgehog BV129 SP6
    Tt smoothened2 BV131 SP6
    Tt nk2.2 BV135 SP6
    Tt nk5 BV139 SP6
    Mm ago2 BV25 SP6
    Mm mago nashi BV27 T7
    Mm germ cell less BV30 T7

    Run the PCR and letting overnight to extract tomorrow.

    16/05/12

    Ran gel and extracted the bands. Looking ok:

    18/05/12

    Started probe synthesis reaction at 10:40. Precipitated around 16h.

    19/05/12

    Terebratalia probes had no pellet (but in fact, I don’t know if I centrifuged it). Membranipora using SP6 had a small pellet and the two T7 ones had a huge pellet. Specs are:

    Gene ng/µL
    Mm Ago2 293.92
    Mm Magoh 3806.73
    Mm GMCL 3147.70

    Diluted to 50 ng/µL and stored at -20 °C.

    21/05/12

    Re-doing the transcription reaction for Terebratalia segmentation genes. Started at 11h, but only put at 37°C at 13h (my bad…). Precipitated at 17h30 using only 5 µL of Lithium Chloride. Could not see any pellet…

    22/05/12

    After centrifuging a thin pellet appeared in the bottom of the tubes. I used Low yield, but enough for making probes:

    Gene ng/µL
    Tt netrin 120.56
    Tt patched 174.64
    Tt hedgehog 120.93
    Tt smo2 107.95
    Tt nk2.2 211.83
    Tt nk5 221.16

    Diluted to 50 ng/µL and stored in the freezer.

     
  • Bruno Vellutini 12:45 on 2012/03/22 Permalink
    Tags: argonaute, , , , , , ,   

    Probe synthesis for Membranipora and Priapulus 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    T7: BV27 (MmMAGOH), BV30 (MmGMCL1), BV34 (PcTudor)
    SP6: BV25 (MmAGO2), BV28 (dicer1), BV35 (PcMaelstrom)

    DID NOT HAPPEN!

     
  • Bruno Vellutini 10:00 on 2012/03/01 Permalink
    Tags: argonaute, , , , , , , ,   

    PCRs for new Membranipora and Priapulus primers 


    Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

    Cloning newly collected genes of Membranipora and Priapulus. Selected genes and primers:

    Membranipora:

    Mm PIWIL1 R1 CCGTTGTTGACCTGATGCCACTTTCG
    Mm PIWIL1 R2 ACGATGTGATGCTCTCCCTGCTCCATTACC
    Mm DDX4 R1 TCTCTGTGTCTTGTCTGGCATACCCATCG
    Mm DDX4 R2 CAGTCACCTTTCTCGGGTTTGGACACTCTC
    Mm AGO2 F CTTCGCACCTCAGAGGGTAG
    Mm AGO2 R CTGGCCCTGAAAGCTACAAG
    Mm MEX3 F CCAGTGAGAGGAGCTGAACC
    Mm MEX3 R CATCACCACCACACAAGAGG
    Mm MAGOH F TCCGCCATTCTTTCTCTTTG
    Mm MAGOH R TGGTTGAATGCAAGATGGAA

    Priapulus:

    Pc PiwiA F GGGTCTTATTCTTTGTTTGC
    Pc PiwiA R TTCACGACACCATCGCAG
    Pc PiwiB R1 TGCGATACTGCCGACCATCTTCTTGTCC
    Pc PiwiB R2 ACGGGATGTGATGGGCTGTAACCTTTCG
    Pc Tudor R1 TCCACAAAATAGTAGGCAAGGCAAGGGCTC
    Pc Tudor R2 ACGCAACAGATGAACACCTCTACGGCTTGG
    Pc Mael F1 CGTGAAAGAGAGCTGGTCCAGTCAGAATGG
    Pc Mael F2 CACCGCTTCATAGCTCCAGGTGAAATCC
    Pc Mael R1 GCGGTGAAATTCCCTCATAATGCCCTTCTC
    Pc Mael R2 TGGACCAGCTCTCTTTCACGCTTATTTCG
    Pc Pum F1 ATGAACGCAGTGCCTTGGAACGACTCTCAC
    Pc Pum F2 GCAGGACGATGCTATGGTCGGCTATTTC

    01/03/2012

    Regular and first round of RACE with the above primers.

    02/03/2012

    Second round of RACE. Run a gel with only 5 µL of each to identify bands to be cut from RACE and direct purify the products of the regular PCR. Ran another gel with the remaining product to cut the bands*. Extracted promising bands and set the ligation reaction at 22:30.

    • Did not like this procedure. It is better to run the RACE PCR in 10 comb gel with whole 25 µL to get more signal and extract more.

    03/03/2012

    Heat-shock transformation and plating. Also ligation for remaining bands (Mm PIWIL1, Pc Tudor 2,3,4, Pc PUM).

    04/03/2012

    Colony PCR.

    05/03/2012

    Colony PCR for the remaining bands and repetition for some that there was no positive colonies.

    image

    06/03/2012

    Plasmid extraction using 1.5 mL of miniprep culture, sequencing reaction, and dropped at the sequencing facility.

    08/03/12

    Sequences BV25-BV64 returned.

    BV25 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV26 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV27 Membranipora membranacea Mago Nashi T7 ok T7
    BV28 Membranipora membranacea Dicer1 T7 ok + SP6
    BV29 Membranipora membranacea Dicer1 T7 ok + SP6
    BV30 Membranipora membranacea Germ Cell Less R2 T7 ok T7
    BV31 Membranipora membranacea PiwiL1 R2 b2 T7 ok T7
    BV32 Membranipora membranacea PiwiL1 R2 b2 T7 ok + SP6
    BV33 Priapulus caudatus PiwiB R2 b2 T7 ok T7
    BV34 Priapulus caudatus Tudor R2 b1 T7 ok T7
    BV35 Priapulus caudatus Maelstrom F2 T7 ok + SP6
    BV36 Priapulus caudatus Maelstrom F2 T7 ok T7
    BV37 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV38 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV39 Priapulus caudatus Tudor R2 b3 T7 ok T7
    BV40 Priapulus caudatus Tudor R2 b3 T7 ok + SP6
    BV41 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV42 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV43 Priapulus caudatus Pumilio F2 T7 ok + SP6
    BV44 Priapulus caudatus Pumilio F2 T7 ok T7
    BV45 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV46 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV47 Membranipora membranacea Mago Nashi SP6 ok + T7
    BV48 Membranipora membranacea Dicer1 SP6 ok SP6
    BV49 Membranipora membranacea Dicer1 SP6 ok SP6
    BV50 Membranipora membranacea Germ Cell Less R2 SP6 ok + T7
    BV51 Membranipora membranacea PiwiL1 R2 b2 SP6 ok + T7
    BV52 Membranipora membranacea PiwiL1 R2 b2 SP6 ok SP6
    BV53 Priapulus caudatus PiwiB R2 b2 SP6 ok + T7
    BV54 Priapulus caudatus Tudor R2 b1 SP6 ok + T7
    BV55 Priapulus caudatus Maelstrom F2 SP6 ok SP6
    BV56 Priapulus caudatus Maelstrom F2 SP6 ok + T7
    BV57 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV58 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV59 Priapulus caudatus Tudor R2 b3 SP6 ok + T7
    BV60 Priapulus caudatus Tudor R2 b3 SP6 ok SP6
    BV61 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV62 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV63 Priapulus caudatus Pumilio F2 SP6 ok SP6
    BV64 Priapulus caudatus Pumilio F2 SP6 ok + T7

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel