Terebratalia vivo-morpholinos engrailed/wnt1


Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

Setting up the first vivo-morpholino assay in Brachiopoda. Here is a description of the oligos prepared by Gene Tools for engrailed and wnt1 genes in Terebratalia.

Ttra engrailed

Translation-blocking

Original sequence: Doutorado:Terebratalia transversa:Loci:Ttra.rna.tri.8524.1
5′ UTR + (ATG) + 25 coding bp:

GACAAGTTTTAATTAATATATGGTTGGATATCGGGACATGCTCTGCGTTGTAATCCACTG
ATCAGCTGTTAGCCGGCCTTTGATACAGATACAGGGACTATGCGAATGTCATTTGGAGGA
ACTAACCACGTCTGGACAACAGTATTATCAGTGAACCTCGGAAAACAGTGAGACGATTCT
CAGAGACAATTTCTATAAACTATACTGAACTAGTTAACATTTTATTTAACAATTTTCCAA
AGGCTGACCCGATATTGATATATCCGGATATACAGGAGAAAACATATCTATAAACAGTCT
GTACT(ATG)ACACTCATACGAATGGATGTGAATG

Selected oligo:
GGATATACAGGAGAAAACATATCTATAA[ACAGTCTGTACT(ATG)ACACTCATAC]GAATGGATGTGA

@morpholino — BLAST results
GTATGAGTGTCATAGTACAGACTGT

@mismatch — BLAST results
GTtTcAGTcTCATAcTACAcACTGT

Splice-blocking

Genomic Ttra en consensus alignment: ~/Biologia/Doutorado/Terebratalia/molecular/morpholinos/Ttra_en_genomic_consensus.aln
25 bp exon + 25 bp intron (position: 17291-17340) — Ttra_en_mo_e2i2:
CAAGATATTCTGACCGACCGTCGTCaggtaaggaattataataatacgtt
Selected oligo:
CAAGATATTCTGACCG[ACCGTCGTCaggtaaggaattataa]taatacgtt

@morpholino — BLAST results
TTATAATTCCTTACCTGACGACGGT

@mismatch — BLAST results
TTAaAAaTCgTTACCTcACcACGGT

Ttra wnt1

Translation blocking

Original sequence: Doutorado:Terebratalia transversa:Loci:Ttra.rna.tri.7468.1
5′ UTR + (ATG) + 25 coding bp:

GGCAGATCCTCAGATCGTATCTTGTCCCTGTTTATAGTCAGTCATGTTCATGTAGAACAC
GTATGTTGTGATTCCCTTTTCTTGTGTTGCACGGATGTACGACAGCTGTATTTGAAAAGC
GACAGCCCGATTGATGAACACTGGGGAACAATGCCGACGCGACATCAAAAGAACTTTTTA
TCAACACGAGGTATTTTAACGTTAATACAGTAGCAGCCTGCCTGAACGAGACCTTCGAAG
CACGAGACATTACTCTAAAATCCAAAACGGGGCGGTCTGATCCTCGATTGCTGTACAATT
TATGGTATGTCACACAATAAACTCGCACAATACACGAGTGTGATTGGCATACAAGAGCGG
CACACATCAAAAGAAGAGAAAGTTCCGCATCAAGCCTTAACATTTTACACGGATACATCG
GACAGTGAACATGTTCTTTTTATTTCGTAAGAGAAAACAGAAGCTGTCCACGTGCAGGAG
TATCAAACGTCACTAATTAATTAAAGTGCGATCTTAATTAATGTGATAAAATTTATTTTA
ACGAAACCACGTGTGGAGTAGACGATCAACCTTTTTAATTGGATTATCAGTTTTGAGCAC
CCTCTTTATTAAAAGTTTACAAAAAGATTTAAAACAGGGACTCAACACTCAGAAGTAAAC
AACATATATATACACTTACGCACACTATTGTGTTTTAAGAATACTTTATTTTTGAAATCG
TTAATCTTTGTCTGTGTATTGGGTCGCGTTACGACATTATTTACTAGTGTTGTTGTGT(A
TG)AGACAAGAATACGACATGAACATCA

Selected oligo:
TAATCTTTGTCTGTGTATTGGGTCGCGTTACGACATTATTTACTAGTGTTGTT[GTGT(ATG)AGACAAGAATACGACATG]AACA

@morpholino — BLAST results
CATGTCGTATTCTTGTCTCATACAC

@mismatch — BLAST results
CATcTCcTATTgTTcTCTgATACAC

Splice-blocking

Genomic Ttra wnt1 consensus alignment: ~/Biologia/Doutorado/Terebratalia/molecular/morpholinos/Ttra_wnt1_genomic_consensus.aln
25 bp exon + 25 bp intron (position: 5186-5235) — Ttra_wnt1_mo_e2i2:
CATTTATACAGAGGCGTACGGTGGTggtaagtaagacaataccttgtatc
Selected oligo:
CATTTATACAGAGGCGTAC[GGTGGTggtaagtaagacaatacct]tgtatc

@morpholino — BLAST results
AGGTATTGTCTTACTTACCACCACC

@mismatch — BLAST results
AGcTATTcTCTTAgTTACgAgCACC

Experiment

24-well plate (500 µL) with humid chamber and keep on incubator. vMO stock concentration: 0.5 mM. Add vMO at swimming blastula stage to prevent any initial translation. I prepared 250 µL of vivo-morpholino dilutions and added 250 µL of embryos.

FSW CTRL STD CTRL vMO 1 µM Ttra_en_TB_vMO 1 µM Ttra_en_SBe2i2_vMO 1 µM Ttra_wnt1_TB_vMO 1 µM Ttra_wnt1_SBe2i2_vMO 1 µM
STD CTRL vMO 5 µM Ttra_en_TB_vMO 5 µM Ttra_en_SBe2i2_vMO 5 µM Ttra_wnt1_TB_vMO 5 µM Ttra_wnt1_SBe2i2_vMO 5 µM
STD CTRL vMO 10 µM Ttra_en_TB_vMO 10 µM Ttra_en_SBe2i2_vMO 10 µM Ttra_wnt1_TB_vMO 10 µM Ttra_wnt1_SBe2i2_vMO 10 µM
STD CTRL vMO 25 µM Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 25 µM Ttra_wnt1_SBe2i2_vMO 25 µM

Incubated 20h late blastula at 7.5 °C in turned off outdoor incubator. ~2 am temperature was 8.5 °C.

11/01/2014

Checked samples during the morning. All wells had actively swimming radial gastrula and some dead embryos. FSW control and 1 µM samples had more active embryos. Letting it go longer.

18:00 All wells with swimming asymmetric gastrula. Ectoderm of larvae at 25 µM seems not perfectly integer. I observed some round flattened gastrula which did not become bilateral on the wnt1 splice-blocking 25 µM well, but might be just a coincidence.

12/01/2014

Embryos still look ok and have reached the bilateral stage. Temperature dropped to 7.0 °C.

I will fix them in RNAlater tonight or tomorrow morning.