Updates from January, 2014 Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 16:18 on 2014/01/21 Permalink
    Tags: , phylogenomics, , transcriptome   

    Dunn Lab – Brown University – Winter 2014 

    From 20/01/2014 to 14/02/2014 I’m staying at Casey Dunn’s Lab to analyze RNAseq data from priapulid development and acoel phylogenomics.

    Everything I’m doing is documented on GitHub: https://github.com/nelas/bcv-at-brown

     
  • Bruno Vellutini 23:20 on 2014/01/16 Permalink
    Tags: ,   

    Azakenpaullone for bilateral gastrula 

    Set Azakanpaullone treatment for bilateral gastrula to see how it affects lobe development.

    CTRL FSW 1 µM Az 10 µM Az

     
  • Bruno Vellutini 14:34 on 2014/01/16 Permalink
    Tags: , , ,   

    Vivo-Morpholino next with pronase and electroporation 

    Considering my last observations of the vivo-morpholinos I’m setting up a new experiment using a lower concentration of pronase, electroporating twice (because I could not figure out how to do longer pulses), and properly washing out the pronase after 1h. Default settings:

    Vivo-Morpholino: 25 µM
    Pronase: 5 µg/mL
    Washing after: 1h
    Electroporation: 50 V, 25 µF, 1000 resistance
    Actual pulses:

    CTRL FSW CTRL Pronase EN TB Pronase EN SB Pronase WNT1 TB Pronase WNT1 SB Pronase
    CTRL Electroporation EN TB Electroporation EN SB Electroporation WNT1 TB Electroporation WNT1 SB Electroporation

     
  • Bruno Vellutini 20:17 on 2014/01/15 Permalink
    Tags: , , ,   

    Terebratalia Vivo-Morpholino engrailed/wnt1 with permeabilization 

    Use 25 µM concentration for vivo-morpholinos.

    CTRL FSW
    CTRL CFSW 1h Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 25 µM Ttra_wnt1_SBe2i2_vMO 25 µM
    CTRL Pronase 10 µg/mL 1h Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 25 µM Ttra_wnt1_SBe2i2_vMO 25 µM
    CTRL Electroporation in CFSW Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 25 µM Ttra_wnt1_SBe2i2_vMO 25 µM

    Electroporation setup

    BioRad Gene Pulser 50V, 25 µF, resistance set to infinity.

    [photo]

    ms
    ctrl 1.1
    en tb 1.0
    en sb 1.1
    wnt1 tb 1.2
    wnt1 sb 0.9

    16/01/14

    • Calcium-free seawater look normal trilobed.
    • Pronase treatment embryos failed to gastrulate, including the control.
    • Electroporation look normal except for wnt1 sb which seem either delayed or did not manage to close the blastopore.
     
  • Bruno Vellutini 23:20 on 2014/01/14 Permalink
    Tags: ,   

    Vivo-Morpholino permeabilization tries 

    Higher concentration of vivo-morpholinos at higher temperatures showed no specific effect on the embryos. So it seems that the vivo-morpholinos are not penetrating the embryos. I’ll try different methods to permeabilize the live embryos to make the oligos go into the cells. List of alternatives:

    • Calcium-free seawater (425 mM NaCl, 9.4 mM KCl, 22.1 mM MgCl2, 25.6 mM MgSO4 , 2.1 mM NaHCO3 , 5 mM EGTA, 5 mM TES, pH 7.8).
    • Cystein (0.2 %).
    • Pronase 1.2 mg/mL (sea urchin eggs).
    • Sodium citrate / Sucrose.
    CFSW 0.2 % Cystein Pronase 10 µg/mL Pronase 1 µg/mL Sodium citrate / Sucrose Control

    Embryos seem unaffected by calcium-free sea water, but were dead instantly in cystein. They are swimming normally in pronase treatments and stuck in the sucrose…

    2h later: CFSW have abnormally spinning embryos, cystein are still dead, pronase treatments are swimming normally and look normal, sucrose have exploded. I split half volume of the CFSW and Pronase 10µg/mL and washed 3x with FSW.

    15/01/14

    CFSW: embryos are trilobed, but spinning without direction and with tissue falling off.
    CFSW washed after 2h: look like regular trilobed with directional swimming. They seem to have recovered from the calcium-free experience.
    Pronase 10 µg/mL: deformed embryos, somehow they failed to elongate and form lobes, even though there is tissue burst where the apical lobe would be.
    Pronase 10 µg/mL washed after 2h: look like normal trilobed larvae, except that when compared to the control larvae they seem to be curved slightly and not swimming much off the bottom.

     
  • Bruno Vellutini 03:50 on 2014/01/13 Permalink
    Tags: , , ,   

    2nd try for vivo-morpholinos in Terebratalia 

    First experiment with vivo-morpholinos showed that 1-25 µM concentration between 7.0-8.5 °C resulted in no observable phenotype (morphological or behavioral) in the embryos. Thus, I’m setting up a new batch using higher temperatures and higher concentration. Female 18.

    10 °C plate

    FSW CTRL STD CTRL vMO 50 µM Ttra_en_TB_vMO 50 µM Ttra_en_SBe2i2_vMO 50 µM Ttra_wnt1_TB_vMO 50 µM Ttra_wnt1_SBe2i2_vMO 50 µM
    STD CTRL vMO 100 µM Ttra_en_TB_vMO 100 µM Ttra_en_SBe2i2_vMO 100 µM Ttra_wnt1_TB_vMO 100 µM Ttra_wnt1_SBe2i2_vMO 100 µM

    RT plate 18 °C

    FSW CTRL STD CTRL vMO 25 µM Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 2 µM Ttra_wnt1_SBe2i2_vMO 25 µM
    STD CTRL vMO 50 µM Ttra_en_TB_vMO 50 µM Ttra_en_SBe2i2_vMO 50 µM Ttra_wnt1_TB_vMO 50 µM Ttra_wnt1_SBe2i2_vMO 50 µM
    STD CTRL vMO 100 µM Ttra_en_TB_vMO 100 µM Ttra_en_SBe2i2_vMO 100 µM Ttra_wnt1_TB_vMO 100 µM Ttra_wnt1_SBe2i2_vMO 100 µM

    Picked the embryos and incubated the plates.

    13/01/14

    Embryos at RT have reached trilobed stage in the morning and look normal at 25 °C. Embryos at higher concentrations 50 and 100 µM are delayed and still around bilateral/bilobed.

    I fixed RT plate for PCR (RNAlater).

     
  • Bruno Vellutini 21:00 on 2014/01/10 Permalink
    Tags: , , ,   

    Terebratalia vivo-morpholinos engrailed/wnt1 

    Setting up the first vivo-morpholino assay in Brachiopoda. Here is a description of the oligos prepared by Gene Tools for engrailed and wnt1 genes in Terebratalia.

    Ttra engrailed

    Translation-blocking

    Original sequence: Doutorado:Terebratalia transversa:Loci:Ttra.rna.tri.8524.1
    5′ UTR + (ATG) + 25 coding bp:

    GACAAGTTTTAATTAATATATGGTTGGATATCGGGACATGCTCTGCGTTGTAATCCACTG
    ATCAGCTGTTAGCCGGCCTTTGATACAGATACAGGGACTATGCGAATGTCATTTGGAGGA
    ACTAACCACGTCTGGACAACAGTATTATCAGTGAACCTCGGAAAACAGTGAGACGATTCT
    CAGAGACAATTTCTATAAACTATACTGAACTAGTTAACATTTTATTTAACAATTTTCCAA
    AGGCTGACCCGATATTGATATATCCGGATATACAGGAGAAAACATATCTATAAACAGTCT
    GTACT(ATG)ACACTCATACGAATGGATGTGAATG

    Selected oligo:
    GGATATACAGGAGAAAACATATCTATAA[ACAGTCTGTACT(ATG)ACACTCATAC]GAATGGATGTGA

    @morpholino — BLAST results
    GTATGAGTGTCATAGTACAGACTGT

    @mismatch — BLAST results
    GTtTcAGTcTCATAcTACAcACTGT

    Splice-blocking

    Genomic Ttra en consensus alignment: ~/Biologia/Doutorado/Terebratalia/molecular/morpholinos/Ttra_en_genomic_consensus.aln
    25 bp exon + 25 bp intron (position: 17291-17340) — Ttra_en_mo_e2i2:
    CAAGATATTCTGACCGACCGTCGTCaggtaaggaattataataatacgtt
    Selected oligo:
    CAAGATATTCTGACCG[ACCGTCGTCaggtaaggaattataa]taatacgtt

    @morpholino — BLAST results
    TTATAATTCCTTACCTGACGACGGT

    @mismatch — BLAST results
    TTAaAAaTCgTTACCTcACcACGGT

    Ttra wnt1

    Translation blocking

    Original sequence: Doutorado:Terebratalia transversa:Loci:Ttra.rna.tri.7468.1
    5′ UTR + (ATG) + 25 coding bp:

    GGCAGATCCTCAGATCGTATCTTGTCCCTGTTTATAGTCAGTCATGTTCATGTAGAACAC
    GTATGTTGTGATTCCCTTTTCTTGTGTTGCACGGATGTACGACAGCTGTATTTGAAAAGC
    GACAGCCCGATTGATGAACACTGGGGAACAATGCCGACGCGACATCAAAAGAACTTTTTA
    TCAACACGAGGTATTTTAACGTTAATACAGTAGCAGCCTGCCTGAACGAGACCTTCGAAG
    CACGAGACATTACTCTAAAATCCAAAACGGGGCGGTCTGATCCTCGATTGCTGTACAATT
    TATGGTATGTCACACAATAAACTCGCACAATACACGAGTGTGATTGGCATACAAGAGCGG
    CACACATCAAAAGAAGAGAAAGTTCCGCATCAAGCCTTAACATTTTACACGGATACATCG
    GACAGTGAACATGTTCTTTTTATTTCGTAAGAGAAAACAGAAGCTGTCCACGTGCAGGAG
    TATCAAACGTCACTAATTAATTAAAGTGCGATCTTAATTAATGTGATAAAATTTATTTTA
    ACGAAACCACGTGTGGAGTAGACGATCAACCTTTTTAATTGGATTATCAGTTTTGAGCAC
    CCTCTTTATTAAAAGTTTACAAAAAGATTTAAAACAGGGACTCAACACTCAGAAGTAAAC
    AACATATATATACACTTACGCACACTATTGTGTTTTAAGAATACTTTATTTTTGAAATCG
    TTAATCTTTGTCTGTGTATTGGGTCGCGTTACGACATTATTTACTAGTGTTGTTGTGT(A
    TG)AGACAAGAATACGACATGAACATCA

    Selected oligo:
    TAATCTTTGTCTGTGTATTGGGTCGCGTTACGACATTATTTACTAGTGTTGTT[GTGT(ATG)AGACAAGAATACGACATG]AACA

    @morpholino — BLAST results
    CATGTCGTATTCTTGTCTCATACAC

    @mismatch — BLAST results
    CATcTCcTATTgTTcTCTgATACAC

    Splice-blocking

    Genomic Ttra wnt1 consensus alignment: ~/Biologia/Doutorado/Terebratalia/molecular/morpholinos/Ttra_wnt1_genomic_consensus.aln
    25 bp exon + 25 bp intron (position: 5186-5235) — Ttra_wnt1_mo_e2i2:
    CATTTATACAGAGGCGTACGGTGGTggtaagtaagacaataccttgtatc
    Selected oligo:
    CATTTATACAGAGGCGTAC[GGTGGTggtaagtaagacaatacct]tgtatc

    @morpholino — BLAST results
    AGGTATTGTCTTACTTACCACCACC

    @mismatch — BLAST results
    AGcTATTcTCTTAgTTACgAgCACC

    Experiment

    24-well plate (500 µL) with humid chamber and keep on incubator. vMO stock concentration: 0.5 mM. Add vMO at swimming blastula stage to prevent any initial translation. I prepared 250 µL of vivo-morpholino dilutions and added 250 µL of embryos.

    FSW CTRL STD CTRL vMO 1 µM Ttra_en_TB_vMO 1 µM Ttra_en_SBe2i2_vMO 1 µM Ttra_wnt1_TB_vMO 1 µM Ttra_wnt1_SBe2i2_vMO 1 µM
    STD CTRL vMO 5 µM Ttra_en_TB_vMO 5 µM Ttra_en_SBe2i2_vMO 5 µM Ttra_wnt1_TB_vMO 5 µM Ttra_wnt1_SBe2i2_vMO 5 µM
    STD CTRL vMO 10 µM Ttra_en_TB_vMO 10 µM Ttra_en_SBe2i2_vMO 10 µM Ttra_wnt1_TB_vMO 10 µM Ttra_wnt1_SBe2i2_vMO 10 µM
    STD CTRL vMO 25 µM Ttra_en_TB_vMO 25 µM Ttra_en_SBe2i2_vMO 25 µM Ttra_wnt1_TB_vMO 25 µM Ttra_wnt1_SBe2i2_vMO 25 µM

    Incubated 20h late blastula at 7.5 °C in turned off outdoor incubator. ~2 am temperature was 8.5 °C.

    11/01/2014

    Checked samples during the morning. All wells had actively swimming radial gastrula and some dead embryos. FSW control and 1 µM samples had more active embryos. Letting it go longer.

    18:00 All wells with swimming asymmetric gastrula. Ectoderm of larvae at 25 µM seems not perfectly integer. I observed some round flattened gastrula which did not become bilateral on the wnt1 splice-blocking 25 µM well, but might be just a coincidence.

    12/01/2014

    Embryos still look ok and have reached the bilateral stage. Temperature dropped to 7.0 °C.

    I will fix them in RNAlater tonight or tomorrow morning.

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel