PCRs for new Membranipora and Priapulus primers


Warning: preg_match_all(): Compilation failed: invalid range in character class at offset 7 in /home/customer/www/phd.organelas.com/public_html/wp-content/themes/p2/inc/mentions.php on line 77

Cloning newly collected genes of Membranipora and Priapulus. Selected genes and primers:

Membranipora:

Mm PIWIL1 R1 CCGTTGTTGACCTGATGCCACTTTCG
Mm PIWIL1 R2 ACGATGTGATGCTCTCCCTGCTCCATTACC
Mm DDX4 R1 TCTCTGTGTCTTGTCTGGCATACCCATCG
Mm DDX4 R2 CAGTCACCTTTCTCGGGTTTGGACACTCTC
Mm AGO2 F CTTCGCACCTCAGAGGGTAG
Mm AGO2 R CTGGCCCTGAAAGCTACAAG
Mm MEX3 F CCAGTGAGAGGAGCTGAACC
Mm MEX3 R CATCACCACCACACAAGAGG
Mm MAGOH F TCCGCCATTCTTTCTCTTTG
Mm MAGOH R TGGTTGAATGCAAGATGGAA

Priapulus:

Pc PiwiA F GGGTCTTATTCTTTGTTTGC
Pc PiwiA R TTCACGACACCATCGCAG
Pc PiwiB R1 TGCGATACTGCCGACCATCTTCTTGTCC
Pc PiwiB R2 ACGGGATGTGATGGGCTGTAACCTTTCG
Pc Tudor R1 TCCACAAAATAGTAGGCAAGGCAAGGGCTC
Pc Tudor R2 ACGCAACAGATGAACACCTCTACGGCTTGG
Pc Mael F1 CGTGAAAGAGAGCTGGTCCAGTCAGAATGG
Pc Mael F2 CACCGCTTCATAGCTCCAGGTGAAATCC
Pc Mael R1 GCGGTGAAATTCCCTCATAATGCCCTTCTC
Pc Mael R2 TGGACCAGCTCTCTTTCACGCTTATTTCG
Pc Pum F1 ATGAACGCAGTGCCTTGGAACGACTCTCAC
Pc Pum F2 GCAGGACGATGCTATGGTCGGCTATTTC

01/03/2012

Regular and first round of RACE with the above primers.

02/03/2012

Second round of RACE. Run a gel with only 5 µL of each to identify bands to be cut from RACE and direct purify the products of the regular PCR. Ran another gel with the remaining product to cut the bands*. Extracted promising bands and set the ligation reaction at 22:30.

  • Did not like this procedure. It is better to run the RACE PCR in 10 comb gel with whole 25 µL to get more signal and extract more.

03/03/2012

Heat-shock transformation and plating. Also ligation for remaining bands (Mm PIWIL1, Pc Tudor 2,3,4, Pc PUM).

04/03/2012

Colony PCR.

05/03/2012

Colony PCR for the remaining bands and repetition for some that there was no positive colonies.

image

06/03/2012

Plasmid extraction using 1.5 mL of miniprep culture, sequencing reaction, and dropped at the sequencing facility.

08/03/12

Sequences BV25-BV64 returned.

BV25 Membranipora membranacea Argonaute2 T7 ok + SP6
BV26 Membranipora membranacea Argonaute2 T7 ok + SP6
BV27 Membranipora membranacea Mago Nashi T7 ok T7
BV28 Membranipora membranacea Dicer1 T7 ok + SP6
BV29 Membranipora membranacea Dicer1 T7 ok + SP6
BV30 Membranipora membranacea Germ Cell Less R2 T7 ok T7
BV31 Membranipora membranacea PiwiL1 R2 b2 T7 ok T7
BV32 Membranipora membranacea PiwiL1 R2 b2 T7 ok + SP6
BV33 Priapulus caudatus PiwiB R2 b2 T7 ok T7
BV34 Priapulus caudatus Tudor R2 b1 T7 ok T7
BV35 Priapulus caudatus Maelstrom F2 T7 ok + SP6
BV36 Priapulus caudatus Maelstrom F2 T7 ok T7
BV37 Priapulus caudatus Tudor R2 b2 T7 ok T7
BV38 Priapulus caudatus Tudor R2 b2 T7 ok T7
BV39 Priapulus caudatus Tudor R2 b3 T7 ok T7
BV40 Priapulus caudatus Tudor R2 b3 T7 ok + SP6
BV41 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
BV42 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
BV43 Priapulus caudatus Pumilio F2 T7 ok + SP6
BV44 Priapulus caudatus Pumilio F2 T7 ok T7
BV45 Membranipora membranacea Argonaute2 SP6 ok SP6
BV46 Membranipora membranacea Argonaute2 SP6 ok SP6
BV47 Membranipora membranacea Mago Nashi SP6 ok + T7
BV48 Membranipora membranacea Dicer1 SP6 ok SP6
BV49 Membranipora membranacea Dicer1 SP6 ok SP6
BV50 Membranipora membranacea Germ Cell Less R2 SP6 ok + T7
BV51 Membranipora membranacea PiwiL1 R2 b2 SP6 ok + T7
BV52 Membranipora membranacea PiwiL1 R2 b2 SP6 ok SP6
BV53 Priapulus caudatus PiwiB R2 b2 SP6 ok + T7
BV54 Priapulus caudatus Tudor R2 b1 SP6 ok + T7
BV55 Priapulus caudatus Maelstrom F2 SP6 ok SP6
BV56 Priapulus caudatus Maelstrom F2 SP6 ok + T7
BV57 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
BV58 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
BV59 Priapulus caudatus Tudor R2 b3 SP6 ok + T7
BV60 Priapulus caudatus Tudor R2 b3 SP6 ok SP6
BV61 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
BV62 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
BV63 Priapulus caudatus Pumilio F2 SP6 ok SP6
BV64 Priapulus caudatus Pumilio F2 SP6 ok + T7