Updates from March, 2012 Toggle Comment Threads | Keyboard Shortcuts

  • Bruno Vellutini 19:00 on 2012/03/29 Permalink
    Tags:   

    I dissected 1 egg mass of Lineus ruber… 

    I dissected 1 egg mass of Lineus ruber today. External case is easy to rip with needles or tweezers. Egg bundles are attached to a sheet which is sticky. It is not so difficult to tear this sheet apart to release the bundles.

    Removing the eggs from the bundle membrane is a bit more tricky. Making a small opening and directing the eggs toward the hole gave better results than pulling the membrane in opposite directions (which would compress and damage the eggs).

    I dissected several eggs completely and kept a bowl with individual eggs and a another with released egg bundles.

     
  • Bruno Vellutini 15:50 on 2012/03/27 Permalink
    Tags:   

    Nemerteans supposedly Lineus ruber layed egg cases today… 

    Nemerteans (supposedly Lineus ruber) layed egg cases today. Transparent sheaths are elongated containing bundles of eggs covered by a iridescent membrane. Eggs are yolky and yellowish (size?); bundles have around 15 eggs. 1 apparently immature egg case had white eggs with 3 eggs per bundle approximately.

    Case has an external sticky layer followed by a bi-layered cilinder, slightly more opaque. Egg bundles are on the main axis of the cilinder distributed in a bilateral manner.

    I cleaned the egg cases removing dirt from the external layer and put them at 18 °C in clean UV sterile filtered sea water.

     
  • Bruno Vellutini 14:15 on 2012/03/27 Permalink
    Tags:   

    L. ruber egg masses 

    Egg mass is alongated and sometimes curved, reflecting the position of worm body when the eggs were laid. Is transparent and composed of a sticky outer layer, a secondary double layer that is slightly opaque, and an inner mass of jelly running along the axis where the bundles are attached in a bilateral manner. Each bundle contains several embryos, from 3-20, protected by a membrane.

     
  • Bruno Vellutini 18:23 on 2012/03/26 Permalink
    Tags: , ,   

    Sequencing PCR for MmVasa 

    T7 SP6
    MmVasa c6 BV65 BV70
    MmVasa c7 BV66 BV71
    MmVasa c10 BV67 BV72
    MmVasa c15 BV68 BV73
    MmVasa c17 BV69 BV74

    Sequencing PCR for colonies screened last week. Products will be dropped by the facility tomorrow.

     
  • Bruno Vellutini 18:00 on 2012/03/23 Permalink
    Tags: , , , , , ,   

    In situ Membranipora nanos, piwi2, maelstrom, pumilio, tudor 

    Treated the samples for 1 min in proteinase-k, and then 2 washes in glycine. Put in prehybe at 20:00.

    25/03/12

    Started hybridization at 14:00.

    27/03/12

    Regular washes.

    29/03/12

    Developing from 11:30.

    Summary

    In the last days there were no embryos left (only some cyphonautes shells). The 1 min prot-k treatment with regular 5 min washes in glycine seems to be too much for them. Also, the longer period in prehybe possibly was not nice either.

     
  • Bruno Vellutini 12:45 on 2012/03/22 Permalink
    Tags: , , , , , , ,   

    Probe synthesis for Membranipora and Priapulus 

    T7: BV27 (MmMAGOH), BV30 (MmGMCL1), BV34 (PcTudor)
    SP6: BV25 (MmAGO2), BV28 (dicer1), BV35 (PcMaelstrom)

    DID NOT HAPPEN!

     
  • Bruno Vellutini 11:56 on 2012/03/22 Permalink
    Tags: , , , , otp, , ,   

    Membranipora primers have arrived: Mm Syt1a, Syt1b, NK2.1, FoxG, Otp, PL10, Fez.

     
  • Bruno Vellutini 18:04 on 2012/03/20 Permalink
    Tags: , ,   

    Colony screening for Mm DDX4 and MEX3 

    I picked 19 colonies from the previous PCRs of Mm DDX4 and Mm MEX3. Trying to find a positive colony, specially for Vasa.

    No positive colonies for MEX3. For Vasa the length was not the same as expected, but I will sequence 6, 7, 10, 15, 17 to check.

     
  • Bruno Vellutini 10:00 on 2012/03/01 Permalink
    Tags: , , , , , , , ,   

    PCRs for new Membranipora and Priapulus primers 

    Cloning newly collected genes of Membranipora and Priapulus. Selected genes and primers:

    Membranipora:

    Mm PIWIL1 R1 CCGTTGTTGACCTGATGCCACTTTCG
    Mm PIWIL1 R2 ACGATGTGATGCTCTCCCTGCTCCATTACC
    Mm DDX4 R1 TCTCTGTGTCTTGTCTGGCATACCCATCG
    Mm DDX4 R2 CAGTCACCTTTCTCGGGTTTGGACACTCTC
    Mm AGO2 F CTTCGCACCTCAGAGGGTAG
    Mm AGO2 R CTGGCCCTGAAAGCTACAAG
    Mm MEX3 F CCAGTGAGAGGAGCTGAACC
    Mm MEX3 R CATCACCACCACACAAGAGG
    Mm MAGOH F TCCGCCATTCTTTCTCTTTG
    Mm MAGOH R TGGTTGAATGCAAGATGGAA

    Priapulus:

    Pc PiwiA F GGGTCTTATTCTTTGTTTGC
    Pc PiwiA R TTCACGACACCATCGCAG
    Pc PiwiB R1 TGCGATACTGCCGACCATCTTCTTGTCC
    Pc PiwiB R2 ACGGGATGTGATGGGCTGTAACCTTTCG
    Pc Tudor R1 TCCACAAAATAGTAGGCAAGGCAAGGGCTC
    Pc Tudor R2 ACGCAACAGATGAACACCTCTACGGCTTGG
    Pc Mael F1 CGTGAAAGAGAGCTGGTCCAGTCAGAATGG
    Pc Mael F2 CACCGCTTCATAGCTCCAGGTGAAATCC
    Pc Mael R1 GCGGTGAAATTCCCTCATAATGCCCTTCTC
    Pc Mael R2 TGGACCAGCTCTCTTTCACGCTTATTTCG
    Pc Pum F1 ATGAACGCAGTGCCTTGGAACGACTCTCAC
    Pc Pum F2 GCAGGACGATGCTATGGTCGGCTATTTC

    01/03/2012

    Regular and first round of RACE with the above primers.

    02/03/2012

    Second round of RACE. Run a gel with only 5 µL of each to identify bands to be cut from RACE and direct purify the products of the regular PCR. Ran another gel with the remaining product to cut the bands*. Extracted promising bands and set the ligation reaction at 22:30.

    • Did not like this procedure. It is better to run the RACE PCR in 10 comb gel with whole 25 µL to get more signal and extract more.

    03/03/2012

    Heat-shock transformation and plating. Also ligation for remaining bands (Mm PIWIL1, Pc Tudor 2,3,4, Pc PUM).

    04/03/2012

    Colony PCR.

    05/03/2012

    Colony PCR for the remaining bands and repetition for some that there was no positive colonies.

    image

    06/03/2012

    Plasmid extraction using 1.5 mL of miniprep culture, sequencing reaction, and dropped at the sequencing facility.

    08/03/12

    Sequences BV25-BV64 returned.

    BV25 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV26 Membranipora membranacea Argonaute2 T7 ok + SP6
    BV27 Membranipora membranacea Mago Nashi T7 ok T7
    BV28 Membranipora membranacea Dicer1 T7 ok + SP6
    BV29 Membranipora membranacea Dicer1 T7 ok + SP6
    BV30 Membranipora membranacea Germ Cell Less R2 T7 ok T7
    BV31 Membranipora membranacea PiwiL1 R2 b2 T7 ok T7
    BV32 Membranipora membranacea PiwiL1 R2 b2 T7 ok + SP6
    BV33 Priapulus caudatus PiwiB R2 b2 T7 ok T7
    BV34 Priapulus caudatus Tudor R2 b1 T7 ok T7
    BV35 Priapulus caudatus Maelstrom F2 T7 ok + SP6
    BV36 Priapulus caudatus Maelstrom F2 T7 ok T7
    BV37 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV38 Priapulus caudatus Tudor R2 b2 T7 ok T7
    BV39 Priapulus caudatus Tudor R2 b3 T7 ok T7
    BV40 Priapulus caudatus Tudor R2 b3 T7 ok + SP6
    BV41 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV42 Priapulus caudatus Tudor R2 b4 T7 ok + SP6
    BV43 Priapulus caudatus Pumilio F2 T7 ok + SP6
    BV44 Priapulus caudatus Pumilio F2 T7 ok T7
    BV45 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV46 Membranipora membranacea Argonaute2 SP6 ok SP6
    BV47 Membranipora membranacea Mago Nashi SP6 ok + T7
    BV48 Membranipora membranacea Dicer1 SP6 ok SP6
    BV49 Membranipora membranacea Dicer1 SP6 ok SP6
    BV50 Membranipora membranacea Germ Cell Less R2 SP6 ok + T7
    BV51 Membranipora membranacea PiwiL1 R2 b2 SP6 ok + T7
    BV52 Membranipora membranacea PiwiL1 R2 b2 SP6 ok SP6
    BV53 Priapulus caudatus PiwiB R2 b2 SP6 ok + T7
    BV54 Priapulus caudatus Tudor R2 b1 SP6 ok + T7
    BV55 Priapulus caudatus Maelstrom F2 SP6 ok SP6
    BV56 Priapulus caudatus Maelstrom F2 SP6 ok + T7
    BV57 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV58 Priapulus caudatus Tudor R2 b2 SP6 ok + T7
    BV59 Priapulus caudatus Tudor R2 b3 SP6 ok + T7
    BV60 Priapulus caudatus Tudor R2 b3 SP6 ok SP6
    BV61 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV62 Priapulus caudatus Tudor R2 b4 SP6 ok SP6
    BV63 Priapulus caudatus Pumilio F2 SP6 ok SP6
    BV64 Priapulus caudatus Pumilio F2 SP6 ok + T7

     
c
Compose new post
j
Next post/Next comment
k
Previous post/Previous comment
r
Reply
e
Edit
o
Show/Hide comments
t
Go to top
l
Go to login
h
Show/Hide help
shift + esc
Cancel