Bugula neritina germline BLASTing

Candidate genes related to germline development were batch BLASTed against the transcriptome of Bugula neritina using the new BLASTer script. Only 2 genes yield transcriptome alignments, Piwi and Pumilio. Here are the reverse BLAST (Bugula sequence against human protein database) results that returned matches (hit the same gene_id of the candidate gene):

gnl|SRA|SRR034781.65778.2		(candidates: PIWIL2, PIWIL1)
	gene		id		accession		e-value
	PIWIL1		9271		NP_004755.2		2.77e-31 <<
	PIWIL1		9271		NP_004755.2		2.77e-31 <<
	PIWIL1		9271		NP_001177900.1		2.77e-31
	PIWIL1		9271		NP_001177900.1		2.77e-31
	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
	PIWIL2		55124		NP_001129193.1		2.45e-29 <<
	PIWIL2		55124		NP_060538.2		2.45e-29
	PIWIL2		55124		NP_060538.2		2.45e-29

gnl|SRA|SRR034781.74499.2		(candidates: PIWIL2)
	gene		id		accession		e-value
	PIWIL1		9271		NP_004755.2		4.21e-33
	PIWIL3		440822		NP_001008496.2		8.22e-29
	PIWIL4		143689		NP_689644.2		2.39e-28
	PIWIL2		55124		NP_001129193.1		1.31e-26 <<
	PIWIL2		55124		NP_060538.2		1.31e-26

gnl|SRA|SRR034781.49286.2		(candidates: PUM2, PUM1)
	gene		id		accession		e-value
	PUM1		9698		NP_001018494.1		1.67e-54 <<
	PUM1		9698		NP_001018494.1		1.67e-54 <<
	PUM1		9698		NP_001018494.1		3.43e-11 <<
	PUM1		9698		NP_001018494.1		1.22e-08 <<
	PUM1		9698		NP_055491.1		1.67e-54
	PUM1		9698		NP_055491.1		1.67e-54
	PUM1		9698		NP_055491.1		2.62e-11
	PUM1		9698		NP_055491.1		1.10e-09

gnl|SRA|SRR034781.80037.2		(candidates: PIWIL2, PIWIL1)
	gene		id		accession		e-value
	PIWIL1		9271		NP_004755.2		4.61e-32 <<
	PIWIL3		440822		NP_001008496.2		5.27e-28
	PIWIL4		143689		NP_689644.2		2.00e-27
	PIWIL2		55124		NP_001129193.1		8.42e-26 <<
	PIWIL2		55124		NP_060538.2		8.42e-26

Complete reverse BLAST results are at results.txt and the sequences themselves at results.fa. Manually selected alignments file is selected.txt.

Obs: low number of hits may be due to the quality of the transcriptome assembly, sequences seem to be short.

Primers

PUM1

5′ and 3′ RACE primers needed

Bn PUM1 F1    48-77      5'- CCAGACCAGACGGATGTGATTCTCTCAGAG -3'
	                    30 nt primer on plus strand
	                    pct G+C:   53.3 	Tm:   72.4
Bn PUM1 F2    136-164    5'- ACGTGCTGGAACACGGTAGACTGGAGGAG -3'
	                    29 nt primer on plus strand
	                    pct G+C:   58.6 	Tm:   74.1

Bn PUM1 R1    456-429    5'- ACTTCCTCAGTGTAGAAACATGGGGGCG -3'
	                    28 nt primer on minus strand
	                    pct G+C:   53.6 	Tm:   72.1
Bn PUM1 R2    120-93     5'- TGCCATACTGATCCATCACCAGTCGGTC -3'
	                    28 nt primer on minus strand
	                    pct G+C:   53.6 	Tm:   73.3

PIWIL1

Only 5′ RACE primers needed.

Bn PIWIL1 R1             5'- AACTGCCCATCTCCAACTCCATCACGGTAG -3'
Bn PIWIL1 R2             5'- TTAGGGAAGCCACAAAACCACCGACAG -3'